EMAIL THIS PAGE TO A FRIEND

MSN

moesin

219 Gene Product Result for
UniProtKB ID: P26038
Gene ID:
Human(4478) Summary: Moesin (for membrane-organizing extension spike protein) is a member of the ERM family which includes ezrin and radixin. ERM proteins appear to function as cross-linkers between plasma membranes and actin-based cytoskeletons. Moesin is localized to filopodia and other membranous protrusions that are important for cell-cell recognition and signaling and for cell movement. [provided by RefSeq, Jul 2008]
Mouse(17698) moesin
Rat(81521) moesin
fruit fly(44030) misshapen
cow(540426) moesin
dog(491924) moesin
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2500638 Anti-Moesin antibody produced in goat affinity isolated antibody, buffered aqueous solution rat, mouse, human, canine
ELISA, western blot pricing
SAB4501926 Anti-Moesin, C-Terminal antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunohistochemistry, western blot pricing
HPA011135 Anti-MSN antibody produced in rabbit Ab1, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human, rat, mouse
immunofluorescence, immunohistochemistry, western blot pricing
HPA011227 Anti-MSN antibody produced in rabbit Ab2, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution mouse, rat, human
immunohistochemistry, western blot pricing
SAB2107749 Anti-MSN antibody produced in rabbit affinity isolated antibody human, guinea pig, horse, mouse, rabbit
ELISA, western blot pricing
SAB2107173 Anti-MSN antibody produced in rabbit affinity isolated antibody rabbit, mouse, human, guinea pig, horse
ELISA, western blot pricing
SAB1410798 Anti-MSN antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB4504260 Anti-phospho-Moesin/Ezrin/Radixin (pThr558) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
M7060 Monoclonal Anti-Moesin antibody produced in mouse clone 38/87, purified immunoglobulin, buffered aqueous solution human, mouse, bovine, rat, pig
ELISA, flow cytometry, immunocytochemistry, immunohistochemistry, immunoprecipitation (IP), western blot pricing
WH0004478M13 Monoclonal Anti-MSN antibody produced in mouse clone 4B8, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB5300421 Monoclonal Anti-MSN antibody produced in mouse clone 2C12, purified immunoglobulin, buffered aqueous solution monkey, human
ELISA, flow cytometry, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010833 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010833 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010833 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002444 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002444 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002444 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002444 Rosetta Predictions human pricing
NM_030863 Rosetta Predictions rat pricing
NM_010833 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002444 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00078502 predicted 522
2 SASI_Hs01_00078503 predicted 860
3 SASI_Hs01_00078504 predicted 1906
4 SASI_Hs01_00078505 predicted 491
5 SASI_Hs01_00078506 predicted 1576
6 SASI_Hs01_00078507 predicted 424
7 SASI_Hs01_00078508 predicted 642
8 SASI_Hs01_00078509 predicted 1899
9 SASI_Hs01_00078511 predicted 794
10 SASI_Hs02_00333846 predicted 780
11 SASI_Hs01_00078510 predicted 1909
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030863 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00052114 predicted 957
2 SASI_Rn01_00052115 predicted 1704
3 SASI_Rn01_00052116 predicted 362
4 SASI_Rn01_00052117 predicted 1789
5 SASI_Rn01_00052118 predicted 828
6 SASI_Rn01_00052119 predicted 208
7 SASI_Rn01_00052120 predicted 1649
8 SASI_Rn01_00052121 predicted 1212
9 SASI_Rn01_00052122 predicted 1544
10 SASI_Rn02_00264113 predicted 312
11 SASI_Rn01_00052123 predicted 705
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010833 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00054906 predicted 574
2 SASI_Mm02_00319462 predicted 850
3 SASI_Mm01_00054907 predicted 918
4 SASI_Mm02_00319463 predicted 788
5 SASI_Mm01_00054908 predicted 1567
6 SASI_Mm01_00054909 predicted 950
7 SASI_Mm01_00054910 predicted 558
8 SASI_Mm01_00054911 predicted 762
9 SASI_Mm01_00054913 predicted 1587
10 SASI_Mm01_00054914 predicted 1242
11 SASI_Mm01_00054912 predicted 1793
12 SASI_Mm01_00054915 predicted 1257
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010833
MSN MISSION shRNA Bacterial Glycerol Stock
moesin
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432209    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010833.2-2397s21c1
Sequence:CCGGTAGGATTTAGCCTCTTAATTACTCGAGTAATTAAGAGGCTAAATCCTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010833.2-917s21c1
Sequence:CCGGGAAATCAGGAATATCTCTTTCCTCGAGGAAAGAGATATTCCTGATTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010833.2-654s21c1
Sequence:CCGGGAGTCTTGGAGCAGCACAAACCTCGAGGTTTGTGCTGCTCCAAGACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010833.2-295s21c1
Sequence:CCCGTATTGGTTTGAGGGAAGTTTGCTCGAGCAAACTTCCCTCAAACCAATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071513    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010833.1-1942s1c1
Sequence:CCGGGCTCTCTAGAATAGAGCATTTCTCGAGAAATGCTCTATTCTAGAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010833.1-357s1c1
Sequence:CCGGCCAGTCTAAGTATGGTGACTTCTCGAGAAGTCACCATACTTAGACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010833.1-1254s1c1
Sequence:CCGGCCAGTTGGAAATGGCTCGAAACTCGAGTTTCGAGCCATTTCCAACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010833.1-786s1c1
Sequence:CCGGGCTTCGGATTAACAAGCGGATCTCGAGATCCGCTTGTTAATCCGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010833.1-293s1c1
Sequence:CCGGGCATTCTCAATGACGACATTTCTCGAGAAATGTCGTCATTGAGAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010833
MSN MISSION shRNA shRNA Plasmid DNA
moesin
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432209    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010833.2-2397s21c1
Sequence:CCGGTAGGATTTAGCCTCTTAATTACTCGAGTAATTAAGAGGCTAAATCCTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010833.2-917s21c1
Sequence:CCGGGAAATCAGGAATATCTCTTTCCTCGAGGAAAGAGATATTCCTGATTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010833.2-654s21c1
Sequence:CCGGGAGTCTTGGAGCAGCACAAACCTCGAGGTTTGTGCTGCTCCAAGACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010833.2-295s21c1
Sequence:CCCGTATTGGTTTGAGGGAAGTTTGCTCGAGCAAACTTCCCTCAAACCAATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071513    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010833.1-1942s1c1
Sequence:CCGGGCTCTCTAGAATAGAGCATTTCTCGAGAAATGCTCTATTCTAGAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010833.1-357s1c1
Sequence:CCGGCCAGTCTAAGTATGGTGACTTCTCGAGAAGTCACCATACTTAGACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010833.1-1254s1c1
Sequence:CCGGCCAGTTGGAAATGGCTCGAAACTCGAGTTTCGAGCCATTTCCAACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010833.1-786s1c1
Sequence:CCGGGCTTCGGATTAACAAGCGGATCTCGAGATCCGCTTGTTAATCCGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010833.1-293s1c1
Sequence:CCGGGCATTCTCAATGACGACATTTCTCGAGAAATGTCGTCATTGAGAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010833
MSN MISSION shRNA Lentiviral Transduction Particles
moesin
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432209    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010833.2-2397s21c1
Sequence:CCGGTAGGATTTAGCCTCTTAATTACTCGAGTAATTAAGAGGCTAAATCCTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010833.2-917s21c1
Sequence:CCGGGAAATCAGGAATATCTCTTTCCTCGAGGAAAGAGATATTCCTGATTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010833.2-654s21c1
Sequence:CCGGGAGTCTTGGAGCAGCACAAACCTCGAGGTTTGTGCTGCTCCAAGACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010833.2-295s21c1
Sequence:CCCGTATTGGTTTGAGGGAAGTTTGCTCGAGCAAACTTCCCTCAAACCAATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071513    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010833.1-1942s1c1
Sequence:CCGGGCTCTCTAGAATAGAGCATTTCTCGAGAAATGCTCTATTCTAGAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010833.1-357s1c1
Sequence:CCGGCCAGTCTAAGTATGGTGACTTCTCGAGAAGTCACCATACTTAGACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010833.1-1254s1c1
Sequence:CCGGCCAGTTGGAAATGGCTCGAAACTCGAGTTTCGAGCCATTTCCAACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010833.1-786s1c1
Sequence:CCGGGCTTCGGATTAACAAGCGGATCTCGAGATCCGCTTGTTAATCCGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010833.1-293s1c1
Sequence:CCGGGCATTCTCAATGACGACATTTCTCGAGAAATGTCGTCATTGAGAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002444
VALIDATED
MSN MISSION shRNA Bacterial Glycerol Stock
moesin
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000333262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002444.2-1020s21c1
Sequence:CCGGGCGGATTAACAAGCGGATCTTCTCGAGAAGATCCGCTTGTTAATCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333264    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_002444.2-3763s21c1
Sequence:CCGGGCTAAATTGAAACCTGGAATTCTCGAGAATTCCAGGTTTCAATTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002444.2-1907s21c1
Sequence:CCGGGCATTGACGAATTTGAGTCTACTCGAGTAGACTCAAATTCGTCAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_002444.2-268s21c1
Sequence:CCGGACCACCGGGAAGCAGCTATTTCTCGAGAAATAGCTGCTTCCCGGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_002444.2-1020s1c1
Sequence:CCGGGCGGATTAACAAGCGGATCTTCTCGAGAAGATCCGCTTGTTAATCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_002444.2-1907s1c1
Sequence:CCGGGCATTGACGAATTTGAGTCTACTCGAGTAGACTCAAATTCGTCAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002444.2-426s1c1
Sequence:CCGGGCTCTTTAAGTTCCGTGCCAACTCGAGTTGGCACGGAACTTAAAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002444.2-588s1c1
Sequence:CCGGCCAGTCTAAGTATGGCGACTTCTCGAGAAGTCGCCATACTTAGACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062408    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_002444.2-3763s1c1
Sequence:CCGGGCTAAATTGAAACCTGGAATTCTCGAGAATTCCAGGTTTCAATTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002444
VALIDATED
MSN MISSION shRNA shRNA Plasmid DNA
moesin
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000333262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002444.2-1020s21c1
Sequence:CCGGGCGGATTAACAAGCGGATCTTCTCGAGAAGATCCGCTTGTTAATCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333264    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_002444.2-3763s21c1
Sequence:CCGGGCTAAATTGAAACCTGGAATTCTCGAGAATTCCAGGTTTCAATTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002444.2-1907s21c1
Sequence:CCGGGCATTGACGAATTTGAGTCTACTCGAGTAGACTCAAATTCGTCAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_002444.2-268s21c1
Sequence:CCGGACCACCGGGAAGCAGCTATTTCTCGAGAAATAGCTGCTTCCCGGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_002444.2-1020s1c1
Sequence:CCGGGCGGATTAACAAGCGGATCTTCTCGAGAAGATCCGCTTGTTAATCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_002444.2-1907s1c1
Sequence:CCGGGCATTGACGAATTTGAGTCTACTCGAGTAGACTCAAATTCGTCAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002444.2-426s1c1
Sequence:CCGGGCTCTTTAAGTTCCGTGCCAACTCGAGTTGGCACGGAACTTAAAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002444.2-588s1c1
Sequence:CCGGCCAGTCTAAGTATGGCGACTTCTCGAGAAGTCGCCATACTTAGACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062408    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_002444.2-3763s1c1
Sequence:CCGGGCTAAATTGAAACCTGGAATTCTCGAGAATTCCAGGTTTCAATTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002444
VALIDATED
MSN MISSION shRNA Lentiviral Transduction Particles
moesin
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000333262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002444.2-1020s21c1
Sequence:CCGGGCGGATTAACAAGCGGATCTTCTCGAGAAGATCCGCTTGTTAATCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333264    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_002444.2-3763s21c1
Sequence:CCGGGCTAAATTGAAACCTGGAATTCTCGAGAATTCCAGGTTTCAATTTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002444.2-1907s21c1
Sequence:CCGGGCATTGACGAATTTGAGTCTACTCGAGTAGACTCAAATTCGTCAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_002444.2-268s21c1
Sequence:CCGGACCACCGGGAAGCAGCTATTTCTCGAGAAATAGCTGCTTCCCGGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_002444.2-1020s1c1
Sequence:CCGGGCGGATTAACAAGCGGATCTTCTCGAGAAGATCCGCTTGTTAATCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_002444.2-1907s1c1
Sequence:CCGGGCATTGACGAATTTGAGTCTACTCGAGTAGACTCAAATTCGTCAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002444.2-426s1c1
Sequence:CCGGGCTCTTTAAGTTCCGTGCCAACTCGAGTTGGCACGGAACTTAAAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002444.2-588s1c1
Sequence:CCGGCCAGTCTAAGTATGGCGACTTCTCGAGAAGTCGCCATACTTAGACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062408    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_002444.2-3763s1c1
Sequence:CCGGGCTAAATTGAAACCTGGAATTCTCGAGAATTCCAGGTTTCAATTTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)