EMAIL THIS PAGE TO A FRIEND

MSR1

macrophage scavenger receptor 1

196 Gene Product Result for
Synonyms: CD204 SCARA1 SR-A SRA phSR1 phSR2
UniProtKB ID: P21757, D3DSP3, O60505, P21759, Q45F10
Gene ID:
Human(4481) Summary: This gene encodes the class A macrophage scavenger receptors, which include three different types (1, 2, 3) generated by alternative splicing of this gene. These receptors or isoforms are macrophage-specific trimeric integral membrane glycoproteins and have been implicated in many macrophage-associated physiological and pathological processes including atherosclerosis, Alzheimer's disease, and host defense. The isoforms type 1 and type 2 are functional receptors and are able to mediate the endocytosis of modified low density lipoproteins (LDLs). The isoform type 3 does not internalize modified LDL (acetyl-LDL) despite having the domain shown to mediate this function in the types 1 and 2 isoforms. It has an altered intracellular processing and is trapped within the endoplasmic reticulum, making it unable to perform endocytosis. The isoform type 3 can inhibit the function of isoforms type 1 and type 2 when co-expressed, indicating a dominant negative effect and suggesting a mechanism for regulation of scavenger receptor activity in macrophages. [provided by RefSeq, Jul 2008]
Mouse(20288) macrophage scavenger receptor 1
Rat(498638) macrophage scavenger receptor 1
Horse(100053116) macrophage scavenger receptor 1
cow(281311) macrophage scavenger receptor 1
domestic cat(101081290) macrophage scavenger receptor 1
dog(482891) macrophage scavenger receptor 1
sheep(101121746) macrophage scavenger receptor 1
naked mole-rat(101712145) macrophage scavenger receptor 1
Domestic Rabbit(100009067) macrophage scavenger receptor 1
domestic guinea pig(100731555) macrophage scavenger receptor 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1719 Human SR-AI ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031195 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_031195 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_031195 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002445 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002445 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002445 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002445 Rosetta Predictions human pricing
NM_138715 Rosetta Predictions human pricing
NM_138716 Rosetta Predictions human pricing
XM_001065601 Rosetta Predictions rat pricing
XM_573919 Rosetta Predictions rat pricing
NM_001113326 Rosetta Predictions mouse pricing
NM_031195 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002445 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00333847 predicted 253
2 SASI_Hs01_00230412 predicted 949
3 SASI_Hs01_00230413 predicted 633
4 SASI_Hs01_00230414 predicted 865
5 SASI_Hs01_00230415 predicted 561
6 SASI_Hs01_00230417 predicted 998
7 SASI_Hs01_00230418 predicted 710
8 SASI_Hs01_00230419 predicted 282
9 SASI_Hs01_00230420 predicted 435
10 SASI_Hs02_00333848 predicted 726
11 SASI_Hs01_00230411 predicted 924
12 SASI_Hs01_00230416 predicted 253
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138715 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00363826 predicted 259
2 SASI_Hs01_00167827 predicted 942
3 SASI_Hs01_00167828 predicted 634
4 SASI_Hs01_00167829 predicted 867
5 SASI_Hs01_00167830 predicted 552
6 SASI_Hs01_00167832 predicted 1000
7 SASI_Hs01_00167833 predicted 715
8 SASI_Hs01_00167834 predicted 277
9 SASI_Hs01_00167835 predicted 434
10 SASI_Hs02_00363827 predicted 730
11 SASI_Hs01_00167826 predicted 917
12 SASI_Hs01_00167831 predicted 253
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138716 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00363828 predicted 260
2 SASI_Hs01_00073542 predicted 944
3 SASI_Hs01_00073543 predicted 631
4 SASI_Hs01_00073544 predicted 860
5 SASI_Hs01_00073545 predicted 557
6 SASI_Hs01_00073547 predicted 994
7 SASI_Hs01_00073548 predicted 710
8 SASI_Hs01_00073549 predicted 279
9 SASI_Hs01_00073550 predicted 432
10 SASI_Hs02_00363829 predicted 722
11 SASI_Hs01_00073541 predicted 918
12 SASI_Hs01_00073546 predicted 250
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001065601 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00314787 predicted 257
2 SASI_Rn02_00314788 predicted 1134
3 SASI_Rn02_00314789 predicted 228
4 SASI_Rn02_00314790 predicted 602
5 SASI_Rn02_00314791 predicted 1213
6 SASI_Rn02_00314792 predicted 1185
7 SASI_Rn02_00314793 predicted 1200
8 SASI_Rn02_00314794 predicted 380
9 SASI_Rn02_00314795 predicted 322
10 SASI_Rn02_00314796 predicted 480
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573919 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00401031 predicted 256
2 SASI_Rn02_00401032 predicted 1138
3 SASI_Rn02_00401033 predicted 229
4 SASI_Rn02_00401034 predicted 604
5 SASI_Rn02_00401035 predicted 1218
6 SASI_Rn02_00401036 predicted 1186
7 SASI_Rn02_00401037 predicted 1201
8 SASI_Rn02_00401038 predicted 380
9 SASI_Rn02_00401039 predicted 315
10 SASI_Rn02_00401040 predicted 474
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113326 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00307353 predicted 345
2 SASI_Mm02_00307354 predicted 381
3 SASI_Mm02_00307355 predicted 512
4 SASI_Mm02_00307356 predicted 634
5 SASI_Mm02_00307357 predicted 402
6 SASI_Mm02_00307358 predicted 573
7 SASI_Mm02_00307359 predicted 527
8 SASI_Mm02_00307360 predicted 536
9 SASI_Mm02_00307361 predicted 381
10 SASI_Mm02_00307362 predicted 230
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031195 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00060280 predicted 343
2 SASI_Mm02_00337047 predicted 382
3 SASI_Mm01_00060283 predicted 513
4 SASI_Mm01_00060285 predicted 639
5 SASI_Mm01_00060287 predicted 401
6 SASI_Mm01_00060288 predicted 576
7 SASI_Mm01_00060289 predicted 523
8 SASI_Mm02_00337048 predicted 532
9 SASI_Mm02_00337049 predicted 378
10 SASI_Mm02_00337050 predicted 228
11 SASI_Mm01_00060281 predicted 969
12 SASI_Mm01_00060282 predicted 546
13 SASI_Mm01_00060284 predicted 1179
14 SASI_Mm01_00060286 predicted 1118
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031195
MSR1 MISSION shRNA Bacterial Glycerol Stock
macrophage scavenger receptor 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431188    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031195.2-1342s21c1
Sequence:CCGGCCATTGACATAAGTACCTTATCTCGAGATAAGGTACTTATGTCAATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031195.2-1055s21c1
Sequence:CCGGTCGGGATCTCCTGGACCTAAACTCGAGTTTAGGTCCAGGAGATCCCGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072038    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031195.1-1127s1c1
Sequence:CCGGCCCTACTATCATCTCCTTAAACTCGAGTTTAAGGAGATGATAGTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031195.1-67s1c1
Sequence:CCGGGCAGTTCAGAATCCGTGAAATCTCGAGATTTCACGGATTCTGAACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031195.1-1049s1c1
Sequence:CCGGAGGCGGATCAAGATCAGTATACTCGAGTATACTGATCTTGATCCGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031195.1-621s1c1
Sequence:CCGGCGTGAATCTACAGCAAAGCAACTCGAGTTGCTTTGCTGTAGATTCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031195.1-456s1c1
Sequence:CCGGGCAACTGACCAAAGACTTAATCTCGAGATTAAGTCTTTGGTCAGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031195.2-482s21c1
Sequence:CCGGACGGAACGCTTCCAGAATTTCCTCGAGGAAATTCTGGAAGCGTTCCGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031195
MSR1 MISSION shRNA shRNA Plasmid DNA
macrophage scavenger receptor 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431188    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031195.2-1342s21c1
Sequence:CCGGCCATTGACATAAGTACCTTATCTCGAGATAAGGTACTTATGTCAATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031195.2-1055s21c1
Sequence:CCGGTCGGGATCTCCTGGACCTAAACTCGAGTTTAGGTCCAGGAGATCCCGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072038    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031195.1-1127s1c1
Sequence:CCGGCCCTACTATCATCTCCTTAAACTCGAGTTTAAGGAGATGATAGTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031195.1-67s1c1
Sequence:CCGGGCAGTTCAGAATCCGTGAAATCTCGAGATTTCACGGATTCTGAACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031195.1-1049s1c1
Sequence:CCGGAGGCGGATCAAGATCAGTATACTCGAGTATACTGATCTTGATCCGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031195.1-621s1c1
Sequence:CCGGCGTGAATCTACAGCAAAGCAACTCGAGTTGCTTTGCTGTAGATTCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031195.1-456s1c1
Sequence:CCGGGCAACTGACCAAAGACTTAATCTCGAGATTAAGTCTTTGGTCAGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031195.2-482s21c1
Sequence:CCGGACGGAACGCTTCCAGAATTTCCTCGAGGAAATTCTGGAAGCGTTCCGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031195
MSR1 MISSION shRNA Lentiviral Transduction Particles
macrophage scavenger receptor 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431188    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031195.2-1342s21c1
Sequence:CCGGCCATTGACATAAGTACCTTATCTCGAGATAAGGTACTTATGTCAATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031195.2-1055s21c1
Sequence:CCGGTCGGGATCTCCTGGACCTAAACTCGAGTTTAGGTCCAGGAGATCCCGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072038    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031195.1-1127s1c1
Sequence:CCGGCCCTACTATCATCTCCTTAAACTCGAGTTTAAGGAGATGATAGTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031195.1-67s1c1
Sequence:CCGGGCAGTTCAGAATCCGTGAAATCTCGAGATTTCACGGATTCTGAACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031195.1-1049s1c1
Sequence:CCGGAGGCGGATCAAGATCAGTATACTCGAGTATACTGATCTTGATCCGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031195.1-621s1c1
Sequence:CCGGCGTGAATCTACAGCAAAGCAACTCGAGTTGCTTTGCTGTAGATTCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031195.1-456s1c1
Sequence:CCGGGCAACTGACCAAAGACTTAATCTCGAGATTAAGTCTTTGGTCAGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031195.2-482s21c1
Sequence:CCGGACGGAACGCTTCCAGAATTTCCTCGAGGAAATTCTGGAAGCGTTCCGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002445
MSR1 MISSION shRNA Bacterial Glycerol Stock
macrophage scavenger receptor 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000029664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002445.2-306s1c1
Sequence:CCGGGCAGTTCTCATCCCTCTCATTCTCGAGAATGAGAGGGATGAGAACTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002445.2-169s1c1
Sequence:CCGGGCTGCTCCGAATCTGTGAAATCTCGAGATTTCACAGATTCGGAGCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002445.2-1097s1c1
Sequence:CCGGGCCAGGAAATTCTGGACCAAACTCGAGTTTGGTCCAGAATTTCCTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002445.2-486s1c1
Sequence:CCGGGAGAAGAGAATCCAGCATATTCTCGAGAATATGCTGGATTCTCTTCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002445.2-911s1c1
Sequence:CCGGGACCTTGAGAAATATCACTTTCTCGAGAAAGTGATATTTCTCAAGGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002445
MSR1 MISSION shRNA shRNA Plasmid DNA
macrophage scavenger receptor 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000029664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002445.2-306s1c1
Sequence:CCGGGCAGTTCTCATCCCTCTCATTCTCGAGAATGAGAGGGATGAGAACTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002445.2-169s1c1
Sequence:CCGGGCTGCTCCGAATCTGTGAAATCTCGAGATTTCACAGATTCGGAGCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002445.2-1097s1c1
Sequence:CCGGGCCAGGAAATTCTGGACCAAACTCGAGTTTGGTCCAGAATTTCCTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002445.2-486s1c1
Sequence:CCGGGAGAAGAGAATCCAGCATATTCTCGAGAATATGCTGGATTCTCTTCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002445.2-911s1c1
Sequence:CCGGGACCTTGAGAAATATCACTTTCTCGAGAAAGTGATATTTCTCAAGGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002445
MSR1 MISSION shRNA Lentiviral Transduction Particles
macrophage scavenger receptor 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000029664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002445.2-306s1c1
Sequence:CCGGGCAGTTCTCATCCCTCTCATTCTCGAGAATGAGAGGGATGAGAACTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002445.2-169s1c1
Sequence:CCGGGCTGCTCCGAATCTGTGAAATCTCGAGATTTCACAGATTCGGAGCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002445.2-1097s1c1
Sequence:CCGGGCCAGGAAATTCTGGACCAAACTCGAGTTTGGTCCAGAATTTCCTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002445.2-486s1c1
Sequence:CCGGGAGAAGAGAATCCAGCATATTCTCGAGAATATGCTGGATTCTCTTCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002445.2-911s1c1
Sequence:CCGGGACCTTGAGAAATATCACTTTCTCGAGAAAGTGATATTTCTCAAGGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)