EMAIL THIS PAGE TO A FRIEND

MSRA

methionine sulfoxide reductase A

59 Gene Product Result for
Synonyms: PMSR
UniProtKB ID: Q9UJ68, E9PAS8, Q52TC4, Q549N4, Q66MI7
Gene ID:
Human(4482) Summary: This protein is ubiquitous and highly conserved. It carries out the enzymatic reduction of methionine sulfoxide to methionine. Human and animal studies have shown the highest levels of expression in kidney and nervous tissue. Its proposed function is the repair of oxidative damage to proteins to restore biological activity. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]
Mouse(110265) methionine sulfoxide reductase A
Rat(29447) methionine sulfoxide reductase A
chicken(422027) methionine sulfoxide reductase A
domestic cat(101082232) methionine sulfoxide reductase A
dog(608103) methionine sulfoxide reductase A
cow(281312) methionine sulfoxide reductase A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026322 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026322 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026322 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_012331 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012331 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012331 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012331 Rosetta Predictions human pricing
NM_053307 Rosetta Predictions rat pricing
NM_026322 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012331 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00228682 predicted 472
2 SASI_Hs01_00228683 predicted 410
3 SASI_Hs01_00228684 predicted 451
4 SASI_Hs01_00228685 predicted 989
5 SASI_Hs01_00228686 predicted 1020
6 SASI_Hs01_00228687 predicted 673
7 SASI_Hs01_00228688 predicted 1091
8 SASI_Hs01_00228689 predicted 450
9 SASI_Hs01_00228690 predicted 382
10 SASI_Hs01_00228691 predicted 952
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053307 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00095877 predicted 346
2 SASI_Rn01_00095878 predicted 609
3 SASI_Rn01_00095879 predicted 235
4 SASI_Rn01_00095880 predicted 820
5 SASI_Rn01_00095881 predicted 573
6 SASI_Rn01_00095882 predicted 780
7 SASI_Rn01_00095883 predicted 311
8 SASI_Rn01_00095884 predicted 949
9 SASI_Rn02_00265717 predicted 376
10 SASI_Rn01_00095885 predicted 881
11 SASI_Rn01_00095886 predicted 394
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026322 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00168428 predicted 825
2 SASI_Mm01_00168430 predicted 1402
3 SASI_Mm01_00168431 predicted 1475
4 SASI_Mm01_00168432 predicted 834
5 SASI_Mm01_00168433 predicted 1035
6 SASI_Mm01_00168434 predicted 1224
7 SASI_Mm02_00330029 predicted 734
8 SASI_Mm01_00168435 predicted 1436
9 SASI_Mm01_00168436 predicted 899
10 SASI_Mm01_00168437 predicted 777
11 SASI_Mm01_00168429 predicted 1365
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026322
VALIDATED
MSRA MISSION shRNA Bacterial Glycerol Stock
methionine sulfoxide reductase A
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000334723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026322.3-834s21c1
Sequence:CCGGCTGGGTCTTGAAAGGAGTGTACTCGAGTACACTCCTTTCAAGACCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026322.3-1031s21c1
Sequence:CCGGGCCAAGGCAATGACTTTGGTACTCGAGTACCAAAGTCATTGCCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026322.3-660s21c1
Sequence:CCGGCGACTCAGCTTCGAAAGTCATCTCGAGATGACTTTCGAAGCTGAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026322.3-1183s21c1
Sequence:CCGGCAAGTGTTCTACTATGCCGAACTCGAGTTCGGCATAGTAGAACACTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_026322.2-262s1c1
Sequence:CCGGCGACTCAGCTTCGAAAGTCATCTCGAGATGACTTTCGAAGCTGAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_026322.2-785s1c1
Sequence:CCGGCAAGTGTTCTACTATGCCGAACTCGAGTTCGGCATAGTAGAACACTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026322.2-436s1c1
Sequence:CCGGCTGGGTCTTGAAAGGAGTGTACTCGAGTACACTCCTTTCAAGACCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_026322.2-802s1c1
Sequence:CCGGCGAAGACTACCACCAGCAATACTCGAGTATTGCTGGTGGTAGTCTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_026322.2-633s1c1
Sequence:CCGGGCCAAGGCAATGACTTTGGTACTCGAGTACCAAAGTCATTGCCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026322
VALIDATED
MSRA MISSION shRNA shRNA Plasmid DNA
methionine sulfoxide reductase A
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000334723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026322.3-834s21c1
Sequence:CCGGCTGGGTCTTGAAAGGAGTGTACTCGAGTACACTCCTTTCAAGACCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026322.3-1031s21c1
Sequence:CCGGGCCAAGGCAATGACTTTGGTACTCGAGTACCAAAGTCATTGCCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026322.3-660s21c1
Sequence:CCGGCGACTCAGCTTCGAAAGTCATCTCGAGATGACTTTCGAAGCTGAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026322.3-1183s21c1
Sequence:CCGGCAAGTGTTCTACTATGCCGAACTCGAGTTCGGCATAGTAGAACACTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_026322.2-262s1c1
Sequence:CCGGCGACTCAGCTTCGAAAGTCATCTCGAGATGACTTTCGAAGCTGAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_026322.2-785s1c1
Sequence:CCGGCAAGTGTTCTACTATGCCGAACTCGAGTTCGGCATAGTAGAACACTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026322.2-436s1c1
Sequence:CCGGCTGGGTCTTGAAAGGAGTGTACTCGAGTACACTCCTTTCAAGACCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_026322.2-802s1c1
Sequence:CCGGCGAAGACTACCACCAGCAATACTCGAGTATTGCTGGTGGTAGTCTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_026322.2-633s1c1
Sequence:CCGGGCCAAGGCAATGACTTTGGTACTCGAGTACCAAAGTCATTGCCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026322
VALIDATED
MSRA MISSION shRNA Lentiviral Transduction Particles
methionine sulfoxide reductase A
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000334723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026322.3-834s21c1
Sequence:CCGGCTGGGTCTTGAAAGGAGTGTACTCGAGTACACTCCTTTCAAGACCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026322.3-1031s21c1
Sequence:CCGGGCCAAGGCAATGACTTTGGTACTCGAGTACCAAAGTCATTGCCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026322.3-660s21c1
Sequence:CCGGCGACTCAGCTTCGAAAGTCATCTCGAGATGACTTTCGAAGCTGAGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026322.3-1183s21c1
Sequence:CCGGCAAGTGTTCTACTATGCCGAACTCGAGTTCGGCATAGTAGAACACTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_026322.2-262s1c1
Sequence:CCGGCGACTCAGCTTCGAAAGTCATCTCGAGATGACTTTCGAAGCTGAGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_026322.2-785s1c1
Sequence:CCGGCAAGTGTTCTACTATGCCGAACTCGAGTTCGGCATAGTAGAACACTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026322.2-436s1c1
Sequence:CCGGCTGGGTCTTGAAAGGAGTGTACTCGAGTACACTCCTTTCAAGACCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_026322.2-802s1c1
Sequence:CCGGCGAAGACTACCACCAGCAATACTCGAGTATTGCTGGTGGTAGTCTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_026322.2-633s1c1
Sequence:CCGGGCCAAGGCAATGACTTTGGTACTCGAGTACCAAAGTCATTGCCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012331
VALIDATED
MSRA MISSION shRNA Bacterial Glycerol Stock
methionine sulfoxide reductase A
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000293702    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012331.3-1312s21c1
Sequence:CCGGTCGCTGAAATCCTTCGCTTTACTCGAGTAAAGCGAAGGATTTCAGCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_012331.3-358s21c1
Sequence:CCGGGCAACAGAACAGTCGAACCTTCTCGAGAAGGTTCGACTGTTCTGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012331.3-444s21c1
Sequence:CCGGTGGGTCTTGAAAGGAGTGTATCTCGAGATACACTCCTTTCAAGACCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012331.3-878s21c1
Sequence:CCGGGTCCTGCCCAGTGGGTATTAACTCGAGTTAATACCCACTGGGCAGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012331.3-483s21c1
Sequence:CCGGGCAGGAGGCTATACTTCAAATCTCGAGATTTGAAGTATAGCCTCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_012331.2-351s1c1
Sequence:CCGGGCGGCCAAACATCATGTCAATCTCGAGATTGACATGATGTTTGGCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_012331.2-498s1c1
Sequence:CCGGGCAGGAGGCTATACTTCAAATCTCGAGATTTGAAGTATAGCCTCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_012331.2-373s1c1
Sequence:CCGGGCAACAGAACAGTCGAACCTTCTCGAGAAGGTTCGACTGTTCTGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_012331.2-459s1c1
Sequence:CCGGTGGGTCTTGAAAGGAGTGTATCTCGAGATACACTCCTTTCAAGACCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012331.2-581s1c1
Sequence:CCGGCCAGCCAGAACACATGAGTTTCTCGAGAAACTCATGTGTTCTGGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012331
VALIDATED
MSRA MISSION shRNA shRNA Plasmid DNA
methionine sulfoxide reductase A
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000293702    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012331.3-1312s21c1
Sequence:CCGGTCGCTGAAATCCTTCGCTTTACTCGAGTAAAGCGAAGGATTTCAGCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_012331.3-358s21c1
Sequence:CCGGGCAACAGAACAGTCGAACCTTCTCGAGAAGGTTCGACTGTTCTGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012331.3-444s21c1
Sequence:CCGGTGGGTCTTGAAAGGAGTGTATCTCGAGATACACTCCTTTCAAGACCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012331.3-878s21c1
Sequence:CCGGGTCCTGCCCAGTGGGTATTAACTCGAGTTAATACCCACTGGGCAGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012331.3-483s21c1
Sequence:CCGGGCAGGAGGCTATACTTCAAATCTCGAGATTTGAAGTATAGCCTCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_012331.2-351s1c1
Sequence:CCGGGCGGCCAAACATCATGTCAATCTCGAGATTGACATGATGTTTGGCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_012331.2-498s1c1
Sequence:CCGGGCAGGAGGCTATACTTCAAATCTCGAGATTTGAAGTATAGCCTCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_012331.2-373s1c1
Sequence:CCGGGCAACAGAACAGTCGAACCTTCTCGAGAAGGTTCGACTGTTCTGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_012331.2-459s1c1
Sequence:CCGGTGGGTCTTGAAAGGAGTGTATCTCGAGATACACTCCTTTCAAGACCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012331.2-581s1c1
Sequence:CCGGCCAGCCAGAACACATGAGTTTCTCGAGAAACTCATGTGTTCTGGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012331
VALIDATED
MSRA MISSION shRNA Lentiviral Transduction Particles
methionine sulfoxide reductase A
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000293702    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012331.3-1312s21c1
Sequence:CCGGTCGCTGAAATCCTTCGCTTTACTCGAGTAAAGCGAAGGATTTCAGCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_012331.3-358s21c1
Sequence:CCGGGCAACAGAACAGTCGAACCTTCTCGAGAAGGTTCGACTGTTCTGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012331.3-444s21c1
Sequence:CCGGTGGGTCTTGAAAGGAGTGTATCTCGAGATACACTCCTTTCAAGACCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012331.3-878s21c1
Sequence:CCGGGTCCTGCCCAGTGGGTATTAACTCGAGTTAATACCCACTGGGCAGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012331.3-483s21c1
Sequence:CCGGGCAGGAGGCTATACTTCAAATCTCGAGATTTGAAGTATAGCCTCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_012331.2-351s1c1
Sequence:CCGGGCGGCCAAACATCATGTCAATCTCGAGATTGACATGATGTTTGGCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_012331.2-498s1c1
Sequence:CCGGGCAGGAGGCTATACTTCAAATCTCGAGATTTGAAGTATAGCCTCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_012331.2-373s1c1
Sequence:CCGGGCAACAGAACAGTCGAACCTTCTCGAGAAGGTTCGACTGTTCTGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_012331.2-459s1c1
Sequence:CCGGTGGGTCTTGAAAGGAGTGTATCTCGAGATACACTCCTTTCAAGACCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012331.2-581s1c1
Sequence:CCGGCCAGCCAGAACACATGAGTTTCTCGAGAAACTCATGTGTTCTGGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)