EMAIL THIS PAGE TO A FRIEND

MSRB1

methionine sulfoxide reductase B1

49 Gene Product Result for
Synonyms: SELR SELX SEPX1 SepR
UniProtKB ID: Q9NZV6, Q96RX6, Q9BTV2, Q9P0B1
Gene ID:
Human(51734) Summary: This gene encodes a selenoprotein, which contains a selenocysteine (Sec) residue at its active site. The selenocysteine is encoded by the UGA codon that normally signals translation termination. The 3' UTR of selenoprotein genes have a common stem-loop structure, the sec insertion sequence (SECIS), that is necessary for the recognition of UGA as a Sec codon rather than as a stop signal. This protein belongs to the methionine sulfoxide reductase (Msr) protein family which includes repair enzymes that reduce oxidized methionine residues in proteins. The protein encoded by this gene is expressed in a variety of adult and fetal tissues and localizes to the cell nucleus and cytosol. [provided by RefSeq, Mar 2012]
Mouse(27361) methionine sulfoxide reductase B1
Rat(685059) methionine sulfoxide reductase B1
Thale Cress(841804) peptide methionine sulfoxide reductase B1
domestic cat(101084761) methionine sulfoxide reductase B1
chicken(416540) methionine sulfoxide reductase B1
sheep(101113899) methionine sulfoxide reductase B1
domestic guinea pig(100729305) methionine sulfoxide reductase B1
naked mole-rat(101724455) methionine sulfoxide reductase B1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016332 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016332 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016332 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013759 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013759 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013759 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU101381 MISSION® esiRNA esiRNA human SEPX1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016332 Rosetta Predictions human pricing
NM_001044285 Rosetta Predictions rat pricing
NM_013759 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016332 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00349282 predicted 431
2 SASI_Hs01_00074313 predicted 656
3 SASI_Hs01_00074314 predicted 539
4 SASI_Hs02_00349283 predicted 718
5 SASI_Hs01_00074316 predicted 202
6 SASI_Hs01_00074317 predicted 301
7 SASI_Hs01_00074318 predicted 916
8 SASI_Hs01_00074319 predicted 517
9 SASI_Hs01_00074320 predicted 268
10 SASI_Hs01_00074321 predicted 360
11 SASI_Hs01_00074315 predicted 870
12 SASI_Hs01_00074322 predicted 356
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001044285 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00205524 predicted 468
2 SASI_Rn02_00205525 predicted 337
3 SASI_Rn02_00205526 predicted 462
4 SASI_Rn02_00205527 predicted 592
5 SASI_Rn02_00205528 predicted 201
6 SASI_Rn02_00205529 predicted 480
7 SASI_Rn02_00205530 predicted 350
8 SASI_Rn02_00205531 predicted 632
9 SASI_Rn02_00205532 predicted 289
10 SASI_Rn02_00205533 predicted 547
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013759 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00322706 predicted 205
2 SASI_Mm01_00170193 predicted 615
3 SASI_Mm01_00170195 predicted 328
4 SASI_Mm02_00322707 predicted 370
5 SASI_Mm01_00170197 predicted 738
6 SASI_Mm01_00170198 predicted 150
7 SASI_Mm01_00170199 predicted 247
8 SASI_Mm01_00170200 predicted 282
9 SASI_Mm01_00170201 predicted 135
10 SASI_Mm01_00170202 predicted 154
11 SASI_Mm01_00170194 predicted 544
12 SASI_Mm01_00170196 predicted 749
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016332
VALIDATED
MSRB1 MISSION shRNA Bacterial Glycerol Stock
methionine sulfoxide reductase B1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000017043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_016332.2-317s1c1
Sequence:CCGGGCACAATAGATCTGAAGCCTTCTCGAGAAGGCTTCAGATCTATTGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016332.2-179s1c1
Sequence:CCGGTCACTTTGAACCTGGCGTTTACTCGAGTAAACGCCAGGTTCAAAGTGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_016332.2-435s1c1
Sequence:CCGGTCGCTGAAGTTTGTCCCTAAACTCGAGTTTAGGGACAAACTTCAGCGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016332.2-407s1c1
Sequence:CCGGGCAGTCCCGATTCTGAATATTCTCGAGAATATTCAGAATCGGGACTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016332.2-267s1c1
Sequence:CCGGCCGGCGTTCACCGAGACCATTCTCGAGAATGGTCTCGGTGAACGCCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016332.2-179s21c1
Sequence:CCGGTCACTTTGAACCTGGCGTTTACTCGAGTAAACGCCAGGTTCAAAGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016332.2-407s21c1
Sequence:CCGGGCAGTCCCGATTCTGAATATTCTCGAGAATATTCAGAATCGGGACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016332.2-267s21c1
Sequence:CCGGCCGGCGTTCACCGAGACCATTCTCGAGAATGGTCTCGGTGAACGCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016332
VALIDATED
MSRB1 MISSION shRNA shRNA Plasmid DNA
methionine sulfoxide reductase B1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000017043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_016332.2-317s1c1
Sequence:CCGGGCACAATAGATCTGAAGCCTTCTCGAGAAGGCTTCAGATCTATTGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016332.2-179s1c1
Sequence:CCGGTCACTTTGAACCTGGCGTTTACTCGAGTAAACGCCAGGTTCAAAGTGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_016332.2-435s1c1
Sequence:CCGGTCGCTGAAGTTTGTCCCTAAACTCGAGTTTAGGGACAAACTTCAGCGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016332.2-407s1c1
Sequence:CCGGGCAGTCCCGATTCTGAATATTCTCGAGAATATTCAGAATCGGGACTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016332.2-267s1c1
Sequence:CCGGCCGGCGTTCACCGAGACCATTCTCGAGAATGGTCTCGGTGAACGCCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016332.2-179s21c1
Sequence:CCGGTCACTTTGAACCTGGCGTTTACTCGAGTAAACGCCAGGTTCAAAGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016332.2-407s21c1
Sequence:CCGGGCAGTCCCGATTCTGAATATTCTCGAGAATATTCAGAATCGGGACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016332.2-267s21c1
Sequence:CCGGCCGGCGTTCACCGAGACCATTCTCGAGAATGGTCTCGGTGAACGCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016332
VALIDATED
MSRB1 MISSION shRNA Lentiviral Transduction Particles
methionine sulfoxide reductase B1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000017043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_016332.2-317s1c1
Sequence:CCGGGCACAATAGATCTGAAGCCTTCTCGAGAAGGCTTCAGATCTATTGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016332.2-179s1c1
Sequence:CCGGTCACTTTGAACCTGGCGTTTACTCGAGTAAACGCCAGGTTCAAAGTGATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_016332.2-435s1c1
Sequence:CCGGTCGCTGAAGTTTGTCCCTAAACTCGAGTTTAGGGACAAACTTCAGCGATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016332.2-407s1c1
Sequence:CCGGGCAGTCCCGATTCTGAATATTCTCGAGAATATTCAGAATCGGGACTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016332.2-267s1c1
Sequence:CCGGCCGGCGTTCACCGAGACCATTCTCGAGAATGGTCTCGGTGAACGCCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016332.2-179s21c1
Sequence:CCGGTCACTTTGAACCTGGCGTTTACTCGAGTAAACGCCAGGTTCAAAGTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016332.2-407s21c1
Sequence:CCGGGCAGTCCCGATTCTGAATATTCTCGAGAATATTCAGAATCGGGACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016332.2-267s21c1
Sequence:CCGGCCGGCGTTCACCGAGACCATTCTCGAGAATGGTCTCGGTGAACGCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013759
VALIDATED
MSRB1 MISSION shRNA Bacterial Glycerol Stock
methionine sulfoxide reductase B1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000081928    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013759.1-476s1c1
Sequence:CCGGGCTCTGGTCAAATCCTTCTATCTCGAGATAGAAGGATTTGACCAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013759.1-227s1c1
Sequence:CCGGCCGACCAGAAGCTTTAAAGGTCTCGAGACCTTTAAAGCTTCTGGTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013759.1-338s1c1
Sequence:CCGGCTCACTGAAGTTCGTCCCTAACTCGAGTTAGGGACGAACTTCAGTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013759.1-113s1c1
Sequence:CCGGCAAGTGCAGCTATGAGCTGTTCTCGAGAACAGCTCATAGCTGCACTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013759.1-131s1c1
Sequence:CCGGGTTCTCCAGTCACTCGAAGTACTCGAGTACTTCGAGTGACTGGAGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013759.2-363s21c1
Sequence:CCGGCTCACTGAAGTTCGTCCCTAACTCGAGTTAGGGACGAACTTCAGTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013759.2-252s21c1
Sequence:CCGGCCGACCAGAAGCTTTAAAGGTCTCGAGACCTTTAAAGCTTCTGGTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013759.2-156s21c1
Sequence:CCGGGTTCTCCAGTCACTCGAAGTACTCGAGTACTTCGAGTGACTGGAGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302077    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013759.2-501s21c1
Sequence:CCGGGCTCTGGTCAAATCCTTCTATCTCGAGATAGAAGGATTTGACCAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013759.2-138s21c1
Sequence:CCGGCAAGTGCAGCTATGAGCTGTTCTCGAGAACAGCTCATAGCTGCACTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013759
VALIDATED
MSRB1 MISSION shRNA shRNA Plasmid DNA
methionine sulfoxide reductase B1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000081928    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013759.1-476s1c1
Sequence:CCGGGCTCTGGTCAAATCCTTCTATCTCGAGATAGAAGGATTTGACCAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013759.1-227s1c1
Sequence:CCGGCCGACCAGAAGCTTTAAAGGTCTCGAGACCTTTAAAGCTTCTGGTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013759.1-338s1c1
Sequence:CCGGCTCACTGAAGTTCGTCCCTAACTCGAGTTAGGGACGAACTTCAGTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013759.1-113s1c1
Sequence:CCGGCAAGTGCAGCTATGAGCTGTTCTCGAGAACAGCTCATAGCTGCACTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013759.1-131s1c1
Sequence:CCGGGTTCTCCAGTCACTCGAAGTACTCGAGTACTTCGAGTGACTGGAGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013759.2-363s21c1
Sequence:CCGGCTCACTGAAGTTCGTCCCTAACTCGAGTTAGGGACGAACTTCAGTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013759.2-252s21c1
Sequence:CCGGCCGACCAGAAGCTTTAAAGGTCTCGAGACCTTTAAAGCTTCTGGTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013759.2-156s21c1
Sequence:CCGGGTTCTCCAGTCACTCGAAGTACTCGAGTACTTCGAGTGACTGGAGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302077    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013759.2-501s21c1
Sequence:CCGGGCTCTGGTCAAATCCTTCTATCTCGAGATAGAAGGATTTGACCAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013759.2-138s21c1
Sequence:CCGGCAAGTGCAGCTATGAGCTGTTCTCGAGAACAGCTCATAGCTGCACTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013759
VALIDATED
MSRB1 MISSION shRNA Lentiviral Transduction Particles
methionine sulfoxide reductase B1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000081928    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013759.1-476s1c1
Sequence:CCGGGCTCTGGTCAAATCCTTCTATCTCGAGATAGAAGGATTTGACCAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013759.1-227s1c1
Sequence:CCGGCCGACCAGAAGCTTTAAAGGTCTCGAGACCTTTAAAGCTTCTGGTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013759.1-338s1c1
Sequence:CCGGCTCACTGAAGTTCGTCCCTAACTCGAGTTAGGGACGAACTTCAGTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013759.1-113s1c1
Sequence:CCGGCAAGTGCAGCTATGAGCTGTTCTCGAGAACAGCTCATAGCTGCACTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013759.1-131s1c1
Sequence:CCGGGTTCTCCAGTCACTCGAAGTACTCGAGTACTTCGAGTGACTGGAGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013759.2-363s21c1
Sequence:CCGGCTCACTGAAGTTCGTCCCTAACTCGAGTTAGGGACGAACTTCAGTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013759.2-252s21c1
Sequence:CCGGCCGACCAGAAGCTTTAAAGGTCTCGAGACCTTTAAAGCTTCTGGTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013759.2-156s21c1
Sequence:CCGGGTTCTCCAGTCACTCGAAGTACTCGAGTACTTCGAGTGACTGGAGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302077    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013759.2-501s21c1
Sequence:CCGGGCTCTGGTCAAATCCTTCTATCTCGAGATAGAAGGATTTGACCAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013759.2-138s21c1
Sequence:CCGGCAAGTGCAGCTATGAGCTGTTCTCGAGAACAGCTCATAGCTGCACTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)