EMAIL THIS PAGE TO A FRIEND

MSRB2

methionine sulfoxide reductase B2

49 Gene Product Result for
Synonyms: CBS-1 CBS1 MSRB PILB
UniProtKB ID: Q9Y3D2, Q17R44, Q4G1C7, Q9Y5W6
Gene ID:
Mouse(76467) methionine sulfoxide reductase B2
Rat(361286) methionine sulfoxide reductase B2
Zebrafish(405857) methionine sulfoxide reductase B2
Thale Cress(828274) peptide methionine sulfoxide reductase B2
dog(608357) methionine sulfoxide reductase B2
cow(613475) methionine sulfoxide reductase B2
naked mole-rat(101703901) methionine sulfoxide reductase B2
domestic guinea pig(100717440) methionine sulfoxide reductase B2
sheep(101113614) methionine sulfoxide reductase B2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012228 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012228 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012228 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029619 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029619 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029619 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012228 Rosetta Predictions human pricing
NM_001031660 Rosetta Predictions rat pricing
NM_029619 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012228 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00076349 predicted 522
2 SASI_Hs01_00076350 predicted 548
3 SASI_Hs01_00076351 predicted 590
4 SASI_Hs02_00343907 predicted 427
5 SASI_Hs01_00076352 predicted 460
6 SASI_Hs01_00076354 predicted 484
7 SASI_Hs01_00076356 predicted 561
8 SASI_Hs01_00076357 predicted 503
9 SASI_Hs01_00076358 predicted 511
10 SASI_Hs02_00343908 predicted 584
11 SASI_Hs01_00076353 predicted 542
12 SASI_Hs01_00076355 predicted 375
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001031660 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00078799 predicted 410
2 SASI_Rn01_00078800 predicted 519
3 SASI_Rn01_00078801 predicted 234
4 SASI_Rn01_00078802 predicted 206
5 SASI_Rn01_00078803 predicted 279
6 SASI_Rn01_00078804 predicted 339
7 SASI_Rn01_00078805 predicted 388
8 SASI_Rn01_00078807 predicted 687
9 SASI_Rn01_00078808 predicted 880
10 SASI_Rn02_00203606 predicted 616
11 SASI_Rn01_00078806 predicted 596
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029619 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00335609 predicted 690
2 SASI_Mm01_00098424 predicted 569
3 SASI_Mm02_00335610 predicted 700
4 SASI_Mm01_00098426 predicted 405
5 SASI_Mm01_00098427 predicted 440
6 SASI_Mm01_00098429 predicted 418
7 SASI_Mm01_00098430 predicted 481
8 SASI_Mm01_00098431 predicted 819
9 SASI_Mm01_00098432 predicted 285
10 SASI_Mm01_00098433 predicted 745
11 SASI_Mm01_00098425 predicted 634
12 SASI_Mm01_00098428 predicted 874
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012228
VALIDATED
MSRB2 MISSION shRNA Bacterial Glycerol Stock
methionine sulfoxide reductase B2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000342920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012228.3-295s21c1
Sequence:CCGGCAGTTCTACGTCACAAGAGAACTCGAGTTCTCTTGTGACGTAGAACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012228.3-336s21c1
Sequence:CCGGCAGTGGGATCTACCTGAATAACTCGAGTTATTCAGGTAGATCCCACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012228.3-562s21c1
Sequence:CCGGGCTCATCTAGGTCACGTGTTTCTCGAGAAACACGTGACCTAGATGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342923    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012228.3-804s21c1
Sequence:CCGGATTTACCTGGAATCAACTTAACTCGAGTTAAGTTGATTCCAGGTAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017798    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012228.2-284s1c1
Sequence:CCGGCAGTGGGATCTACCTGAATAACTCGAGTTATTCAGGTAGATCCCACTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012228.2-573s1c1
Sequence:CCGGAGTGTGGCTTTGAAGTTCAAACTCGAGTTTGAACTTCAAAGCCACACTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012228.2-510s1c1
Sequence:CCGGGCTCATCTAGGTCACGTGTTTCTCGAGAAACACGTGACCTAGATGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012228.2-243s1c1
Sequence:CCGGCAGTTCTACGTCACAAGAGAACTCGAGTTCTCTTGTGACGTAGAACTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012228.2-489s1c1
Sequence:CCGGGTTGTCTGCAAGCAGTGTGAACTCGAGTTCACACTGCTTGCAGACAACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012228
VALIDATED
MSRB2 MISSION shRNA shRNA Plasmid DNA
methionine sulfoxide reductase B2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000342920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012228.3-295s21c1
Sequence:CCGGCAGTTCTACGTCACAAGAGAACTCGAGTTCTCTTGTGACGTAGAACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012228.3-336s21c1
Sequence:CCGGCAGTGGGATCTACCTGAATAACTCGAGTTATTCAGGTAGATCCCACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012228.3-562s21c1
Sequence:CCGGGCTCATCTAGGTCACGTGTTTCTCGAGAAACACGTGACCTAGATGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342923    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012228.3-804s21c1
Sequence:CCGGATTTACCTGGAATCAACTTAACTCGAGTTAAGTTGATTCCAGGTAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017798    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012228.2-284s1c1
Sequence:CCGGCAGTGGGATCTACCTGAATAACTCGAGTTATTCAGGTAGATCCCACTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012228.2-573s1c1
Sequence:CCGGAGTGTGGCTTTGAAGTTCAAACTCGAGTTTGAACTTCAAAGCCACACTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012228.2-510s1c1
Sequence:CCGGGCTCATCTAGGTCACGTGTTTCTCGAGAAACACGTGACCTAGATGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012228.2-243s1c1
Sequence:CCGGCAGTTCTACGTCACAAGAGAACTCGAGTTCTCTTGTGACGTAGAACTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012228.2-489s1c1
Sequence:CCGGGTTGTCTGCAAGCAGTGTGAACTCGAGTTCACACTGCTTGCAGACAACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012228
VALIDATED
MSRB2 MISSION shRNA Lentiviral Transduction Particles
methionine sulfoxide reductase B2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000342920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012228.3-295s21c1
Sequence:CCGGCAGTTCTACGTCACAAGAGAACTCGAGTTCTCTTGTGACGTAGAACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012228.3-336s21c1
Sequence:CCGGCAGTGGGATCTACCTGAATAACTCGAGTTATTCAGGTAGATCCCACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012228.3-562s21c1
Sequence:CCGGGCTCATCTAGGTCACGTGTTTCTCGAGAAACACGTGACCTAGATGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342923    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012228.3-804s21c1
Sequence:CCGGATTTACCTGGAATCAACTTAACTCGAGTTAAGTTGATTCCAGGTAAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017798    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012228.2-284s1c1
Sequence:CCGGCAGTGGGATCTACCTGAATAACTCGAGTTATTCAGGTAGATCCCACTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012228.2-573s1c1
Sequence:CCGGAGTGTGGCTTTGAAGTTCAAACTCGAGTTTGAACTTCAAAGCCACACTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012228.2-510s1c1
Sequence:CCGGGCTCATCTAGGTCACGTGTTTCTCGAGAAACACGTGACCTAGATGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012228.2-243s1c1
Sequence:CCGGCAGTTCTACGTCACAAGAGAACTCGAGTTCTCTTGTGACGTAGAACTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012228.2-489s1c1
Sequence:CCGGGTTGTCTGCAAGCAGTGTGAACTCGAGTTCACACTGCTTGCAGACAACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029619
VALIDATED
MSRB2 MISSION shRNA Bacterial Glycerol Stock
methionine sulfoxide reductase B2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000287125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029619.2-417s21c1
Sequence:CCGGAGACGACTGGACACTTCCTTACTCGAGTAAGGAAGTGTCCAGTCGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029619.2-243s21c1
Sequence:CCGGGCGCCTTTCAGTGGAATGTATCTCGAGATACATTCCACTGAAAGGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029619.2-133s21c1
Sequence:CCGGGCAAGGACACAGGGTCTCTTACTCGAGTAAGAGACCCTGTGTCCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294620    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029619.2-1004s21c1
Sequence:CCGGACATACCCATGATGATATAATCTCGAGATTATATCATCATGGGTATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029619.2-478s21c1
Sequence:CCGGCTCACCTTGGCCATGTGTTTCCTCGAGGAAACACATGGCCAAGGTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029619.2-243s1c1
Sequence:CCGGGCGCCTTTCAGTGGAATGTATCTCGAGATACATTCCACTGAAAGGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029619.2-251s1c1
Sequence:CCGGCAGTGGAATGTATTTGAACAACTCGAGTTGTTCAAATACATTCCACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029619.2-392s1c1
Sequence:CCGGAGATGAAAGTCACACAGGGATCTCGAGATCCCTGTGTGACTTTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029619.2-133s1c1
Sequence:CCGGGCAAGGACACAGGGTCTCTTACTCGAGTAAGAGACCCTGTGTCCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029619.2-417s1c1
Sequence:CCGGAGACGACTGGACACTTCCTTACTCGAGTAAGGAAGTGTCCAGTCGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029619
VALIDATED
MSRB2 MISSION shRNA shRNA Plasmid DNA
methionine sulfoxide reductase B2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000287125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029619.2-417s21c1
Sequence:CCGGAGACGACTGGACACTTCCTTACTCGAGTAAGGAAGTGTCCAGTCGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029619.2-243s21c1
Sequence:CCGGGCGCCTTTCAGTGGAATGTATCTCGAGATACATTCCACTGAAAGGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029619.2-133s21c1
Sequence:CCGGGCAAGGACACAGGGTCTCTTACTCGAGTAAGAGACCCTGTGTCCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294620    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029619.2-1004s21c1
Sequence:CCGGACATACCCATGATGATATAATCTCGAGATTATATCATCATGGGTATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029619.2-478s21c1
Sequence:CCGGCTCACCTTGGCCATGTGTTTCCTCGAGGAAACACATGGCCAAGGTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029619.2-243s1c1
Sequence:CCGGGCGCCTTTCAGTGGAATGTATCTCGAGATACATTCCACTGAAAGGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029619.2-251s1c1
Sequence:CCGGCAGTGGAATGTATTTGAACAACTCGAGTTGTTCAAATACATTCCACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029619.2-392s1c1
Sequence:CCGGAGATGAAAGTCACACAGGGATCTCGAGATCCCTGTGTGACTTTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029619.2-133s1c1
Sequence:CCGGGCAAGGACACAGGGTCTCTTACTCGAGTAAGAGACCCTGTGTCCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029619.2-417s1c1
Sequence:CCGGAGACGACTGGACACTTCCTTACTCGAGTAAGGAAGTGTCCAGTCGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029619
VALIDATED
MSRB2 MISSION shRNA Lentiviral Transduction Particles
methionine sulfoxide reductase B2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000287125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029619.2-417s21c1
Sequence:CCGGAGACGACTGGACACTTCCTTACTCGAGTAAGGAAGTGTCCAGTCGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029619.2-243s21c1
Sequence:CCGGGCGCCTTTCAGTGGAATGTATCTCGAGATACATTCCACTGAAAGGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029619.2-133s21c1
Sequence:CCGGGCAAGGACACAGGGTCTCTTACTCGAGTAAGAGACCCTGTGTCCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294620    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029619.2-1004s21c1
Sequence:CCGGACATACCCATGATGATATAATCTCGAGATTATATCATCATGGGTATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029619.2-478s21c1
Sequence:CCGGCTCACCTTGGCCATGTGTTTCCTCGAGGAAACACATGGCCAAGGTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029619.2-243s1c1
Sequence:CCGGGCGCCTTTCAGTGGAATGTATCTCGAGATACATTCCACTGAAAGGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029619.2-251s1c1
Sequence:CCGGCAGTGGAATGTATTTGAACAACTCGAGTTGTTCAAATACATTCCACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029619.2-392s1c1
Sequence:CCGGAGATGAAAGTCACACAGGGATCTCGAGATCCCTGTGTGACTTTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029619.2-133s1c1
Sequence:CCGGGCAAGGACACAGGGTCTCTTACTCGAGTAAGAGACCCTGTGTCCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029619.2-417s1c1
Sequence:CCGGAGACGACTGGACACTTCCTTACTCGAGTAAGGAAGTGTCCAGTCGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)