EMAIL THIS PAGE TO A FRIEND

MSRB3

methionine sulfoxide reductase B3

200 Gene Product Result for
Synonyms: DFNB74
UniProtKB ID: Q8IXL7, B4DR19, B7ZAQ0, Q6UXS2
Gene ID:
Human(253827) Summary: The protein encoded by this gene catalyzes the reduction of methionine sulfoxide to methionine. This enzyme acts as a monomer and requires zinc as a cofactor. Several transcript variants encoding two different isoforms have been found for this gene. One of the isoforms localizes to mitochondria while the other localizes to endoplasmic reticula. [provided by RefSeq, Jul 2010]
Mouse(320183) methionine sulfoxide reductase B3
Rat(680036) methionine sulfoxide reductase B3
sheep(101108734) methionine sulfoxide reductase B3
domestic guinea pig(100735961) methionine sulfoxide reductase B3
naked mole-rat(101707169) methionine sulfoxide reductase B3
Zebrafish(415184) methionine sulfoxide reductase B3
cow(617849) methionine sulfoxide reductase B3
domestic cat(101089369) methionine sulfoxide reductase B3
dog(608386) methionine sulfoxide reductase B3
chicken(417833) methionine sulfoxide reductase B3
Thale Cress(825817) peptide methionine sulfoxide reductase B3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177092 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177092 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177092 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_198080 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198080 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198080 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001031679 Rosetta Predictions human pricing
NM_198080 Rosetta Predictions human pricing
XM_001055430 Rosetta Predictions rat pricing
NM_177092 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001031679 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00083990 predicted 972
2 SASI_Hs01_00083991 predicted 515
3 SASI_Hs01_00083992 predicted 999
4 SASI_Hs01_00083993 predicted 660
5 SASI_Hs01_00083994 predicted 602
6 SASI_Hs01_00083995 predicted 771
7 SASI_Hs01_00083996 predicted 781
8 SASI_Hs01_00083997 predicted 952
9 SASI_Hs01_00083998 predicted 934
10 SASI_Hs01_00083999 predicted 941
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198080 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00055970 predicted 843
2 SASI_Hs01_00055971 predicted 388
3 SASI_Hs01_00055972 predicted 881
4 SASI_Hs01_00055973 predicted 528
5 SASI_Hs01_00055974 predicted 473
6 SASI_Hs01_00055975 predicted 643
7 SASI_Hs01_00055976 predicted 654
8 SASI_Hs01_00055977 predicted 826
9 SASI_Hs01_00055978 predicted 804
10 SASI_Hs01_00055979 predicted 819
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055430 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00279482 predicted 218
2 SASI_Rn02_00279483 predicted 142
3 SASI_Rn02_00279484 predicted 357
4 SASI_Rn02_00279485 predicted 213
5 SASI_Rn02_00279486 predicted 347
6 SASI_Rn02_00279487 predicted 356
7 SASI_Rn02_00279488 predicted 336
8 SASI_Rn02_00279489 predicted 220
9 SASI_Rn02_00279490 predicted 226
10 SASI_Rn02_00279491 predicted 162
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177092 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00081748 predicted 1159
2 SASI_Mm01_00081749 predicted 428
3 SASI_Mm01_00081750 predicted 386
4 SASI_Mm01_00081751 predicted 368
5 SASI_Mm01_00081752 predicted 423
6 SASI_Mm01_00081753 predicted 1231
7 SASI_Mm01_00081754 predicted 1180
8 SASI_Mm01_00081755 predicted 478
9 SASI_Mm01_00081756 predicted 545
10 SASI_Mm01_00081757 predicted 1204
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177092
VALIDATED
MSRB3 MISSION shRNA Bacterial Glycerol Stock
methionine sulfoxide reductase B3
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000414495    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177092.4-926s21c1
Sequence:CCGGAGTTCTGCCCATCCATGTATTCTCGAGAATACATGGATGGGCAGAACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414057    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177092.4-835s21c1
Sequence:CCGGGAAGCTATAAGGGCAGTTTATCTCGAGATAAACTGCCCTTATAGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177092.4-368s21c1
Sequence:CCGGCCTTTGAAGGAGAGTACACACCTCGAGGTGTGTACTCTCCTTCAAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177092.4-391s21c1
Sequence:CCGGCACAAAGATCCTGGAATATATCTCGAGATATATTCCAGGATCTTTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177092.2-397s1c1
Sequence:CCGGACTCCGTTGTTCAAGTCAGAACTCGAGTTCTGACTTGAACAACGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177092.2-219s1c1
Sequence:CCGGCTCAGGGTCATGTAGGGATAACTCGAGTTATCCCTACATGACCCTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177092.2-593s1c1
Sequence:CCGGGATACTGCATCAACTCAGCATCTCGAGATGCTGAGTTGATGCAGTATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177092.2-477s1c1
Sequence:CCGGCATCGAGTTCACAGATGACTTCTCGAGAAGTCATCTGTGAACTCGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426589    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177092.4-1219s21c1
Sequence:CCGGTAGATTGCTAGGCTGCGATAACTCGAGTTATCGCAGCCTAGCAATCTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177092.4-680s21c1
Sequence:CCGGCAGAAGGAAGCGGCATCAAAGCTCGAGCTTTGATGCCGCTTCCTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177092.2-300s1c1
Sequence:CCGGGTACCATGTCACTCAGGAGAACTCGAGTTCTCCTGAGTGACATGGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177092
VALIDATED
MSRB3 MISSION shRNA shRNA Plasmid DNA
methionine sulfoxide reductase B3
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000414495    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177092.4-926s21c1
Sequence:CCGGAGTTCTGCCCATCCATGTATTCTCGAGAATACATGGATGGGCAGAACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414057    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177092.4-835s21c1
Sequence:CCGGGAAGCTATAAGGGCAGTTTATCTCGAGATAAACTGCCCTTATAGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177092.4-368s21c1
Sequence:CCGGCCTTTGAAGGAGAGTACACACCTCGAGGTGTGTACTCTCCTTCAAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177092.4-391s21c1
Sequence:CCGGCACAAAGATCCTGGAATATATCTCGAGATATATTCCAGGATCTTTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177092.2-397s1c1
Sequence:CCGGACTCCGTTGTTCAAGTCAGAACTCGAGTTCTGACTTGAACAACGGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177092.2-219s1c1
Sequence:CCGGCTCAGGGTCATGTAGGGATAACTCGAGTTATCCCTACATGACCCTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177092.2-593s1c1
Sequence:CCGGGATACTGCATCAACTCAGCATCTCGAGATGCTGAGTTGATGCAGTATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177092.2-477s1c1
Sequence:CCGGCATCGAGTTCACAGATGACTTCTCGAGAAGTCATCTGTGAACTCGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426589    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177092.4-1219s21c1
Sequence:CCGGTAGATTGCTAGGCTGCGATAACTCGAGTTATCGCAGCCTAGCAATCTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177092.4-680s21c1
Sequence:CCGGCAGAAGGAAGCGGCATCAAAGCTCGAGCTTTGATGCCGCTTCCTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177092.2-300s1c1
Sequence:CCGGGTACCATGTCACTCAGGAGAACTCGAGTTCTCCTGAGTGACATGGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177092
VALIDATED
MSRB3 MISSION shRNA Lentiviral Transduction Particles
methionine sulfoxide reductase B3
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000414495    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177092.4-926s21c1
Sequence:CCGGAGTTCTGCCCATCCATGTATTCTCGAGAATACATGGATGGGCAGAACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414057    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177092.4-835s21c1
Sequence:CCGGGAAGCTATAAGGGCAGTTTATCTCGAGATAAACTGCCCTTATAGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177092.4-368s21c1
Sequence:CCGGCCTTTGAAGGAGAGTACACACCTCGAGGTGTGTACTCTCCTTCAAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177092.4-391s21c1
Sequence:CCGGCACAAAGATCCTGGAATATATCTCGAGATATATTCCAGGATCTTTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177092.2-397s1c1
Sequence:CCGGACTCCGTTGTTCAAGTCAGAACTCGAGTTCTGACTTGAACAACGGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177092.2-219s1c1
Sequence:CCGGCTCAGGGTCATGTAGGGATAACTCGAGTTATCCCTACATGACCCTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177092.2-593s1c1
Sequence:CCGGGATACTGCATCAACTCAGCATCTCGAGATGCTGAGTTGATGCAGTATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177092.2-477s1c1
Sequence:CCGGCATCGAGTTCACAGATGACTTCTCGAGAAGTCATCTGTGAACTCGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426589    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177092.4-1219s21c1
Sequence:CCGGTAGATTGCTAGGCTGCGATAACTCGAGTTATCGCAGCCTAGCAATCTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177092.4-680s21c1
Sequence:CCGGCAGAAGGAAGCGGCATCAAAGCTCGAGCTTTGATGCCGCTTCCTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177092.2-300s1c1
Sequence:CCGGGTACCATGTCACTCAGGAGAACTCGAGTTCTCCTGAGTGACATGGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198080
VALIDATED
MSRB3 MISSION shRNA Bacterial Glycerol Stock
methionine sulfoxide reductase B3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000294008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198080.2-155s21c1
Sequence:CCGGTCCGGGTCGTGTAGGGATAAACTCGAGTTTATCCCTACACGACCCGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198080.1-532s1c1
Sequence:CCGGCTGCATAAATTCGGCTGCCTTCTCGAGAAGGCAGCCGAATTTATGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_198080.1-318s1c1
Sequence:CCGGGTGTTGTTTGTGGAACTCCATCTCGAGATGGAGTTCCACAAACAACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_198080.1-332s1c1
Sequence:CCGGACTCCATTGTTTAAGTCAGAACTCGAGTTCTGACTTAAACAATGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_198080.1-277s1c1
Sequence:CCGGAGGAGAATACACACATCACAACTCGAGTTGTGATGTGTGTATTCTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_198080.1-384s1c1
Sequence:CCGGCATTCCACGATGTGATCAATTCTCGAGAATTGATCACATCGTGGAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198080.2-247s21c1
Sequence:CCGGTCAGGAGAAAGGGACCGAAAGCTCGAGCTTTCGGTCCCTTTCTCCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294009    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198080.2-824s21c1
Sequence:CCGGCAAGAACTGTTTATAGCTTTACTCGAGTAAAGCTATAAACAGTTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198080.2-384s21c1
Sequence:CCGGCATTCCACGATGTGATCAATTCTCGAGAATTGATCACATCGTGGAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198080
VALIDATED
MSRB3 MISSION shRNA shRNA Plasmid DNA
methionine sulfoxide reductase B3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000294008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198080.2-155s21c1
Sequence:CCGGTCCGGGTCGTGTAGGGATAAACTCGAGTTTATCCCTACACGACCCGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198080.1-532s1c1
Sequence:CCGGCTGCATAAATTCGGCTGCCTTCTCGAGAAGGCAGCCGAATTTATGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_198080.1-318s1c1
Sequence:CCGGGTGTTGTTTGTGGAACTCCATCTCGAGATGGAGTTCCACAAACAACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_198080.1-332s1c1
Sequence:CCGGACTCCATTGTTTAAGTCAGAACTCGAGTTCTGACTTAAACAATGGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_198080.1-277s1c1
Sequence:CCGGAGGAGAATACACACATCACAACTCGAGTTGTGATGTGTGTATTCTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_198080.1-384s1c1
Sequence:CCGGCATTCCACGATGTGATCAATTCTCGAGAATTGATCACATCGTGGAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198080.2-247s21c1
Sequence:CCGGTCAGGAGAAAGGGACCGAAAGCTCGAGCTTTCGGTCCCTTTCTCCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294009    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198080.2-824s21c1
Sequence:CCGGCAAGAACTGTTTATAGCTTTACTCGAGTAAAGCTATAAACAGTTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198080.2-384s21c1
Sequence:CCGGCATTCCACGATGTGATCAATTCTCGAGAATTGATCACATCGTGGAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198080
VALIDATED
MSRB3 MISSION shRNA Lentiviral Transduction Particles
methionine sulfoxide reductase B3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000294008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198080.2-155s21c1
Sequence:CCGGTCCGGGTCGTGTAGGGATAAACTCGAGTTTATCCCTACACGACCCGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198080.1-532s1c1
Sequence:CCGGCTGCATAAATTCGGCTGCCTTCTCGAGAAGGCAGCCGAATTTATGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_198080.1-318s1c1
Sequence:CCGGGTGTTGTTTGTGGAACTCCATCTCGAGATGGAGTTCCACAAACAACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_198080.1-332s1c1
Sequence:CCGGACTCCATTGTTTAAGTCAGAACTCGAGTTCTGACTTAAACAATGGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_198080.1-277s1c1
Sequence:CCGGAGGAGAATACACACATCACAACTCGAGTTGTGATGTGTGTATTCTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_198080.1-384s1c1
Sequence:CCGGCATTCCACGATGTGATCAATTCTCGAGAATTGATCACATCGTGGAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198080.2-247s21c1
Sequence:CCGGTCAGGAGAAAGGGACCGAAAGCTCGAGCTTTCGGTCCCTTTCTCCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294009    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198080.2-824s21c1
Sequence:CCGGCAAGAACTGTTTATAGCTTTACTCGAGTAAAGCTATAAACAGTTCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198080.2-384s21c1
Sequence:CCGGCATTCCACGATGTGATCAATTCTCGAGAATTGATCACATCGTGGAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)