EMAIL THIS PAGE TO A FRIEND

MSS51

MSS51 mitochondrial translational activator

123 Gene Product Result for
Synonyms: ZMYND17
UniProtKB ID: Q4VC12, A6NGH6, Q2VP95, Q5F2H5, Q7Z3M9, Q8N8G0
Gene ID:
Mouse(74843) MSS51 mitochondrial translational activator
Rat(289904) MSS51 mitochondrial translational activator
chicken(769454) MSS51 mitochondrial translational activator homolog (S. cerevisiae)
domestic cat(101086677) MSS51 mitochondrial translational activator homolog (S. cerevisiae)
sheep(101119107) MSS51 mitochondrial translational activator homolog (S. cerevisiae)
naked mole-rat(101707807) MSS51 mitochondrial translational activator
domestic guinea pig(100719152) MSS51 mitochondrial translational activator
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001024593 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001024593 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001024593 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178451 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178451 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178451 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_127602 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_127602 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_127602 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001024593 Rosetta Predictions human pricing
NM_001106025 Rosetta Predictions rat pricing
XM_214130 Rosetta Predictions rat pricing
XM_127602 Rosetta Predictions mouse pricing
XM_907249 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024593 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00120152 predicted 312
2 SASI_Hs01_00120153 predicted 1363
3 SASI_Hs01_00120154 predicted 645
4 SASI_Hs01_00120155 predicted 699
5 SASI_Hs01_00120156 predicted 308
6 SASI_Hs01_00120157 predicted 1216
7 SASI_Hs02_00307173 predicted 432
8 SASI_Hs01_00120158 predicted 363
9 SASI_Hs01_00120159 predicted 1025
10 SASI_Hs01_00120161 predicted 317
11 SASI_Hs01_00120160 predicted 440
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106025 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00214882 predicted 1093
2 SASI_Rn02_00214883 predicted 446
3 SASI_Rn02_00214884 predicted 651
4 SASI_Rn02_00214885 predicted 1195
5 SASI_Rn02_00214886 predicted 416
6 SASI_Rn02_00214887 predicted 371
7 SASI_Rn02_00214888 predicted 1277
8 SASI_Rn02_00214889 predicted 623
9 SASI_Rn02_00214890 predicted 1077
10 SASI_Rn02_00214891 predicted 685
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_214130 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00178759 predicted 1025
2 SASI_Rn01_00178760 predicted 1307
3 SASI_Rn01_00178761 predicted 587
4 SASI_Rn01_00178762 predicted 1133
5 SASI_Rn01_00178763 predicted 342
6 SASI_Rn01_00178764 predicted 302
7 SASI_Rn01_00178765 predicted 1213
8 SASI_Rn01_00178766 predicted 561
9 SASI_Rn01_00178767 predicted 1010
10 SASI_Rn01_00178768 predicted 619
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_127602 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00245706 predicted 1392
2 SASI_Mm02_00424229 predicted 1308
3 SASI_Mm02_00424230 predicted 1268
4 SASI_Mm01_00245707 predicted 1340
5 SASI_Mm02_00424231 predicted 1313
6 SASI_Mm02_00424232 predicted 1312
7 SASI_Mm01_00245709 predicted 1372
8 SASI_Mm01_00245710 predicted 1327
9 SASI_Mm01_00245711 predicted 1419
10 SASI_Mm01_00245713 predicted 1412
11 SASI_Mm01_00245708 predicted 1413
12 SASI_Mm01_00245712 predicted 1427
13 SASI_Mm01_00245714 predicted 1370
14 SASI_Mm01_00245715 predicted 1339
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_907249 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00433175 predicted 870
2 SASI_Mm02_00433176 predicted 659
3 SASI_Mm02_00433177 predicted 1315
4 SASI_Mm02_00433178 predicted 645
5 SASI_Mm02_00433179 predicted 545
6 SASI_Mm02_00433180 predicted 647
7 SASI_Mm02_00433181 predicted 909
8 SASI_Mm02_00433182 predicted 376
9 SASI_Mm02_00433183 predicted 918
10 SASI_Mm02_00433184 predicted 343
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001024593
MSS51 MISSION shRNA Bacterial Glycerol Stock
MSS51 mitochondrial translational activator
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000234372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024593.1-1359s21c1
Sequence:CCGGATACTGCAGTGCATACTATATCTCGAGATATAGTATGCACTGCAGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024593.1-1183s21c1
Sequence:CCGGCTGCTACTTCGTGACTATAAGCTCGAGCTTATAGTCACGAAGTAGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234373    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001024593.1-1991s21c1
Sequence:CCGGTGGTCTTTCCAGAGCTTATAGCTCGAGCTATAAGCTCTGGAAAGACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024593.1-1316s21c1
Sequence:CCGGTCAAACCTGAACAGGTCTATTCTCGAGAATAGACCTGTTCAGGTTTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024593.1-1403s21c1
Sequence:GTACCGGAGCTGGATAATAGGCAATTAGCTCGAGCTAATTGCCTATTATCCAGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001024593
MSS51 MISSION shRNA shRNA Plasmid DNA
MSS51 mitochondrial translational activator
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000234372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024593.1-1359s21c1
Sequence:CCGGATACTGCAGTGCATACTATATCTCGAGATATAGTATGCACTGCAGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024593.1-1183s21c1
Sequence:CCGGCTGCTACTTCGTGACTATAAGCTCGAGCTTATAGTCACGAAGTAGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234373    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001024593.1-1991s21c1
Sequence:CCGGTGGTCTTTCCAGAGCTTATAGCTCGAGCTATAAGCTCTGGAAAGACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024593.1-1316s21c1
Sequence:CCGGTCAAACCTGAACAGGTCTATTCTCGAGAATAGACCTGTTCAGGTTTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024593.1-1403s21c1
Sequence:GTACCGGAGCTGGATAATAGGCAATTAGCTCGAGCTAATTGCCTATTATCCAGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001024593
MSS51 MISSION shRNA Lentiviral Transduction Particles
MSS51 mitochondrial translational activator
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000234372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024593.1-1359s21c1
Sequence:CCGGATACTGCAGTGCATACTATATCTCGAGATATAGTATGCACTGCAGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024593.1-1183s21c1
Sequence:CCGGCTGCTACTTCGTGACTATAAGCTCGAGCTTATAGTCACGAAGTAGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234373    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001024593.1-1991s21c1
Sequence:CCGGTGGTCTTTCCAGAGCTTATAGCTCGAGCTATAAGCTCTGGAAAGACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024593.1-1316s21c1
Sequence:CCGGTCAAACCTGAACAGGTCTATTCTCGAGAATAGACCTGTTCAGGTTTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024593.1-1403s21c1
Sequence:GTACCGGAGCTGGATAATAGGCAATTAGCTCGAGCTAATTGCCTATTATCCAGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178451
MSS51 MISSION shRNA Bacterial Glycerol Stock
MSS51 mitochondrial translational activator
Human
1 Products Total
TRC Number Price Set Price (1)? Select
TRCN0000167870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178451.2-358s1c1
Sequence:CCGGGATGGAAGACACATTTCGATTCTCGAGAATCGAAATGTGTCTTCCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178451
MSS51 MISSION shRNA shRNA Plasmid DNA
MSS51 mitochondrial translational activator
Human
1 Products Total
TRC Number Vector Price Set Price (1)? Select
TRCN0000167870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178451.2-358s1c1
Sequence:CCGGGATGGAAGACACATTTCGATTCTCGAGAATCGAAATGTGTCTTCCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178451
MSS51 MISSION shRNA Lentiviral Transduction Particles
MSS51 mitochondrial translational activator
Human
1 Products Total
TRC Number Volume Titer Vector Price Set Price (1)? Select
TRCN0000167870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178451.2-358s1c1
Sequence:CCGGGATGGAAGACACATTTCGATTCTCGAGAATCGAAATGTGTCTTCCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_127602
MSS51 MISSION shRNA Bacterial Glycerol Stock
MSS51 mitochondrial translational activator
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000225687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_127602.4-502s21c1
Sequence:CCGGGAATACAAGTTGGTGATAAATCTCGAGATTTATCACCAACTTGTATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_127602.4-1118s21c1
Sequence:CCGGTTATTCGTTCTGGAGATTATGCTCGAGCATAATCTCCAGAACGAATAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_127602.4-1539s21c1
Sequence:GTACCGGCAAACCAGAACAAGTCTATTCCTCGAGGAATAGACTTGTTCTGGTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_127602.4-413s21c1
Sequence:GTACCGGTTGATGCACTTGGCTTCATTTCTCGAGAAATGAAGCCAAGTGCATCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_127602.4-1564s21c1
Sequence:CCGGCCCAACAAGCAACCAGTATACCTCGAGGTATACTGGTTGCTTGTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_127602
MSS51 MISSION shRNA shRNA Plasmid DNA
MSS51 mitochondrial translational activator
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000225687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_127602.4-502s21c1
Sequence:CCGGGAATACAAGTTGGTGATAAATCTCGAGATTTATCACCAACTTGTATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000225688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_127602.4-1118s21c1
Sequence:CCGGTTATTCGTTCTGGAGATTATGCTCGAGCATAATCTCCAGAACGAATAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_127602.4-1539s21c1
Sequence:GTACCGGCAAACCAGAACAAGTCTATTCCTCGAGGAATAGACTTGTTCTGGTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_127602.4-413s21c1
Sequence:GTACCGGTTGATGCACTTGGCTTCATTTCTCGAGAAATGAAGCCAAGTGCATCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000225689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_127602.4-1564s21c1
Sequence:CCGGCCCAACAAGCAACCAGTATACCTCGAGGTATACTGGTTGCTTGTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_127602
MSS51 MISSION shRNA Lentiviral Transduction Particles
MSS51 mitochondrial translational activator
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000225687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_127602.4-502s21c1
Sequence:CCGGGAATACAAGTTGGTGATAAATCTCGAGATTTATCACCAACTTGTATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_127602.4-1118s21c1
Sequence:CCGGTTATTCGTTCTGGAGATTATGCTCGAGCATAATCTCCAGAACGAATAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_127602.4-1539s21c1
Sequence:GTACCGGCAAACCAGAACAAGTCTATTCCTCGAGGAATAGACTTGTTCTGGTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_127602.4-413s21c1
Sequence:GTACCGGTTGATGCACTTGGCTTCATTTCTCGAGAAATGAAGCCAAGTGCATCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_127602.4-1564s21c1
Sequence:CCGGCCCAACAAGCAACCAGTATACCTCGAGGTATACTGGTTGCTTGTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)