EMAIL THIS PAGE TO A FRIEND

MST1

macrophage stimulating 1 (hepatocyte growth factor-like)

164 Gene Product Result for
Synonyms: D3F15S2 DNF15S2 HGFL MSP NF15S2
UniProtKB ID: P26927, A6NLA3, A8MSX3, Q13350, Q14870, Q6GTN4
Gene ID:
Human(4485) Summary: The protein encoded by this gene contains four kringle domains and a serine protease domain, similar to that found in hepatic growth factor. Despite the presence of the serine protease domain, the encoded protein may not have any proteolytic activity. The receptor for this protein is RON tyrosine kinase, which upon activation stimulates ciliary motility of ciliated epithelial lung cells. This protein is secreted and cleaved to form an alpha chain and a beta chain bridged by disulfide bonds. [provided by RefSeq, Jan 2010]
Mouse(15235) macrophage stimulating 1 (hepatocyte growth factor-like)
Rat(24566) Macrophage stimulating 1 (hepatocyte growth factor-like)
Zebrafish(259260) macrophage stimulating 1 (hepatocyte growth factor-like)
cow(514667) macrophage stimulating 1 (hepatocyte growth factor-like)
Horse(100062782) macrophage stimulating 1 (hepatocyte growth factor-like)
domestic cat(101086125) macrophage stimulating 1 (hepatocyte growth factor-like)
dog(484768) macrophage stimulating 1 (hepatocyte growth factor-like)
chicken(396135) macrophage stimulating 1 (hepatocyte growth factor-like)
Thale Cress(844264) mercaptopyruvate sulfurtransferase 1
domestic guinea pig(100734937) macrophage stimulating 1 (hepatocyte growth factor-like)
naked mole-rat(101716165) macrophage stimulating 1 (hepatocyte growth factor-like)
sheep(101103018) macrophage stimulating 1 (hepatocyte growth factor-like)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008243 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008243 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008243 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020998 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020998 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020998 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020998 Rosetta Predictions human pricing
NM_024352 Rosetta Predictions rat pricing
NM_008243 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020998 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00161455 predicted 1917
2 SASI_Hs01_00161457 predicted 1502
3 SASI_Hs01_00161459 predicted 974
4 SASI_Hs01_00161462 predicted 2147
5 SASI_Hs01_00161456 predicted 418
6 SASI_Hs01_00161458 predicted 1511
7 SASI_Hs01_00161460 predicted 1575
8 SASI_Hs01_00161461 predicted 32
9 SASI_Hs01_00161463 predicted 34
10 SASI_Hs01_00161464 predicted 80
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024352 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00112539 predicted 320
2 SASI_Rn01_00112540 predicted 1002
3 SASI_Rn01_00112541 predicted 899
4 SASI_Rn01_00112542 predicted 1020
5 SASI_Rn01_00112543 predicted 1514
6 SASI_Rn01_00112544 predicted 730
7 SASI_Rn01_00112546 predicted 723
8 SASI_Rn01_00112547 predicted 1442
9 SASI_Rn01_00112548 predicted 1599
10 SASI_Rn02_00263909 predicted 775
11 SASI_Rn01_00112545 predicted 1239
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008243 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00027343 predicted 788
2 SASI_Mm01_00027344 predicted 1015
3 SASI_Mm01_00027346 predicted 920
4 SASI_Mm01_00027347 predicted 1031
5 SASI_Mm01_00027348 predicted 1893
6 SASI_Mm01_00027349 predicted 1641
7 SASI_Mm01_00027350 predicted 1461
8 SASI_Mm01_00027351 predicted 1636
9 SASI_Mm01_00027352 predicted 1770
10 SASI_Mm02_00313436 predicted 1344
11 SASI_Mm01_00027345 predicted 1948
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008243
VALIDATED
MST1 MISSION shRNA Bacterial Glycerol Stock
macrophage stimulating 1 (hepatocyte growth factor-like)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000033166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008243.2-350s1c1
Sequence:CCGGCGGACCTGCATTATGGACAATCTCGAGATTGTCCATAATGCAGGTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008243.2-1645s1c1
Sequence:CCGGCGAGGTATGGTTGGGTACAATCTCGAGATTGTACCCAACCATACCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008243.2-793s1c1
Sequence:CCGGCCCGAATGTTGAGCGAGAATTCTCGAGAATTCTCGCTCAACATTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008243.2-1930s1c1
Sequence:CCGGCCAGGAATGTAACACGAAGTACTCGAGTACTTCGTGTTACATTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008243.2-1037s1c1
Sequence:CCGGCGTGAGAATTTCTGCCGGAATCTCGAGATTCCGGCAGAAATTCTCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008243.2-1248s21c1
Sequence:CCGGCACCGCACAAGCCACAATTTACTCGAGTAAATTGTGGCTTGTGCGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008243.2-1037s21c1
Sequence:CCGGCGTGAGAATTTCTGCCGGAATCTCGAGATTCCGGCAGAAATTCTCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008243.2-793s21c1
Sequence:CCGGCCCGAATGTTGAGCGAGAATTCTCGAGAATTCTCGCTCAACATTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008243.2-350s21c1
Sequence:CCGGCGGACCTGCATTATGGACAATCTCGAGATTGTCCATAATGCAGGTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008243.2-1930s21c1
Sequence:CCGGCCAGGAATGTAACACGAAGTACTCGAGTACTTCGTGTTACATTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008243
VALIDATED
MST1 MISSION shRNA shRNA Plasmid DNA
macrophage stimulating 1 (hepatocyte growth factor-like)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000033166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008243.2-350s1c1
Sequence:CCGGCGGACCTGCATTATGGACAATCTCGAGATTGTCCATAATGCAGGTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008243.2-1645s1c1
Sequence:CCGGCGAGGTATGGTTGGGTACAATCTCGAGATTGTACCCAACCATACCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008243.2-793s1c1
Sequence:CCGGCCCGAATGTTGAGCGAGAATTCTCGAGAATTCTCGCTCAACATTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008243.2-1930s1c1
Sequence:CCGGCCAGGAATGTAACACGAAGTACTCGAGTACTTCGTGTTACATTCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008243.2-1037s1c1
Sequence:CCGGCGTGAGAATTTCTGCCGGAATCTCGAGATTCCGGCAGAAATTCTCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008243.2-1248s21c1
Sequence:CCGGCACCGCACAAGCCACAATTTACTCGAGTAAATTGTGGCTTGTGCGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008243.2-1037s21c1
Sequence:CCGGCGTGAGAATTTCTGCCGGAATCTCGAGATTCCGGCAGAAATTCTCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008243.2-793s21c1
Sequence:CCGGCCCGAATGTTGAGCGAGAATTCTCGAGAATTCTCGCTCAACATTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008243.2-350s21c1
Sequence:CCGGCGGACCTGCATTATGGACAATCTCGAGATTGTCCATAATGCAGGTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008243.2-1930s21c1
Sequence:CCGGCCAGGAATGTAACACGAAGTACTCGAGTACTTCGTGTTACATTCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008243
VALIDATED
MST1 MISSION shRNA Lentiviral Transduction Particles
macrophage stimulating 1 (hepatocyte growth factor-like)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000033166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008243.2-350s1c1
Sequence:CCGGCGGACCTGCATTATGGACAATCTCGAGATTGTCCATAATGCAGGTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008243.2-1645s1c1
Sequence:CCGGCGAGGTATGGTTGGGTACAATCTCGAGATTGTACCCAACCATACCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008243.2-793s1c1
Sequence:CCGGCCCGAATGTTGAGCGAGAATTCTCGAGAATTCTCGCTCAACATTCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008243.2-1930s1c1
Sequence:CCGGCCAGGAATGTAACACGAAGTACTCGAGTACTTCGTGTTACATTCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008243.2-1037s1c1
Sequence:CCGGCGTGAGAATTTCTGCCGGAATCTCGAGATTCCGGCAGAAATTCTCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008243.2-1248s21c1
Sequence:CCGGCACCGCACAAGCCACAATTTACTCGAGTAAATTGTGGCTTGTGCGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008243.2-1037s21c1
Sequence:CCGGCGTGAGAATTTCTGCCGGAATCTCGAGATTCCGGCAGAAATTCTCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008243.2-793s21c1
Sequence:CCGGCCCGAATGTTGAGCGAGAATTCTCGAGAATTCTCGCTCAACATTCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008243.2-350s21c1
Sequence:CCGGCGGACCTGCATTATGGACAATCTCGAGATTGTCCATAATGCAGGTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008243.2-1930s21c1
Sequence:CCGGCCAGGAATGTAACACGAAGTACTCGAGTACTTCGTGTTACATTCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020998
MST1 MISSION shRNA Bacterial Glycerol Stock
macrophage stimulating 1 (hepatocyte growth factor-like)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000053848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020998.2-1851s1c1
Sequence:CCGGCGGGTAATGACACAGTCCTAACTCGAGTTAGGACTGTGTCATTACCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020998.2-416s1c1
Sequence:CCGGAGCCACAAGTTCCCGAATGATCTCGAGATCATTCGGGAACTTGTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020998.2-1544s1c1
Sequence:CCGGCTAGTGAAGGAGCAGTGGATACTCGAGTATCCACTGCTCCTTCACTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020998.2-2105s1c1
Sequence:CCGGTCTGTGTTTGTGGACTGGATTCTCGAGAATCCAGTCCACAAACACAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020998.2-719s1c1
Sequence:CCGGGACGACAACTATTGCCGGAATCTCGAGATTCCGGCAATAGTTGTCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020998.3-2131s21c1
Sequence:CCGGTGGGTCCTGGAAGGAATTATACTCGAGTATAATTCCTTCCAGGACCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020998.3-1314s21c1
Sequence:CCGGCAAGCCGCAGTTCACGTTTACCTCGAGGTAAACGTGAACTGCGGCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020998.3-437s21c1
Sequence:CCGGGGACCTGCATCATGAACAATGCTCGAGCATTGTTCATGATGCAGGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020998
MST1 MISSION shRNA shRNA Plasmid DNA
macrophage stimulating 1 (hepatocyte growth factor-like)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000053848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020998.2-1851s1c1
Sequence:CCGGCGGGTAATGACACAGTCCTAACTCGAGTTAGGACTGTGTCATTACCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020998.2-416s1c1
Sequence:CCGGAGCCACAAGTTCCCGAATGATCTCGAGATCATTCGGGAACTTGTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020998.2-1544s1c1
Sequence:CCGGCTAGTGAAGGAGCAGTGGATACTCGAGTATCCACTGCTCCTTCACTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020998.2-2105s1c1
Sequence:CCGGTCTGTGTTTGTGGACTGGATTCTCGAGAATCCAGTCCACAAACACAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020998.2-719s1c1
Sequence:CCGGGACGACAACTATTGCCGGAATCTCGAGATTCCGGCAATAGTTGTCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020998.3-2131s21c1
Sequence:CCGGTGGGTCCTGGAAGGAATTATACTCGAGTATAATTCCTTCCAGGACCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020998.3-1314s21c1
Sequence:CCGGCAAGCCGCAGTTCACGTTTACCTCGAGGTAAACGTGAACTGCGGCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020998.3-437s21c1
Sequence:CCGGGGACCTGCATCATGAACAATGCTCGAGCATTGTTCATGATGCAGGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020998
MST1 MISSION shRNA Lentiviral Transduction Particles
macrophage stimulating 1 (hepatocyte growth factor-like)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000053848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020998.2-1851s1c1
Sequence:CCGGCGGGTAATGACACAGTCCTAACTCGAGTTAGGACTGTGTCATTACCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020998.2-416s1c1
Sequence:CCGGAGCCACAAGTTCCCGAATGATCTCGAGATCATTCGGGAACTTGTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020998.2-1544s1c1
Sequence:CCGGCTAGTGAAGGAGCAGTGGATACTCGAGTATCCACTGCTCCTTCACTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020998.2-2105s1c1
Sequence:CCGGTCTGTGTTTGTGGACTGGATTCTCGAGAATCCAGTCCACAAACACAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020998.2-719s1c1
Sequence:CCGGGACGACAACTATTGCCGGAATCTCGAGATTCCGGCAATAGTTGTCGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020998.3-2131s21c1
Sequence:CCGGTGGGTCCTGGAAGGAATTATACTCGAGTATAATTCCTTCCAGGACCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020998.3-1314s21c1
Sequence:CCGGCAAGCCGCAGTTCACGTTTACCTCGAGGTAAACGTGAACTGCGGCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020998.3-437s21c1
Sequence:CCGGGGACCTGCATCATGAACAATGCTCGAGCATTGTTCATGATGCAGGTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)