EMAIL THIS PAGE TO A FRIEND

MST1R

macrophage stimulating 1 receptor (c-met-related tyrosine kinase)

79 Gene Product Result for
Synonyms: CD136 CDw136 PTK8 RON
UniProtKB ID: Q04912, B5A944, B5A945, B5A946, B5A947
Gene ID:
Human(4486) Summary: This gene encodes a cell surface receptor for macrophage-stimulating protein (MSP) with tyrosine kinase activity. The mature form of this protein is a heterodimer of disulfide-linked alpha and beta subunits, generated by proteolytic cleavage of a single-chain precursor. The beta subunit undergoes tyrosine phosphorylation upon stimulation by MSP. This protein is expressed on the ciliated epithelia of the mucociliary transport apparatus of the lung, and together with MSP, thought to be involved in host defense. Alternatively spliced transcript variants encoding different isoforms with different structural and biochemical properties have been described (PMID:8816464). [provided by RefSeq, Oct 2011]
Mouse(19882) macrophage stimulating 1 receptor (c-met-related tyrosine kinase)
Rat(300999) macrophage stimulating 1 receptor (c-met-related tyrosine kinase)
chicken(427573) macrophage stimulating 1 receptor (c-met-related tyrosine kinase)
domestic cat(101089993) macrophage stimulating 1 receptor (c-met-related tyrosine kinase)
cow(525504) macrophage stimulating 1 receptor (c-met-related tyrosine kinase)
Horse(100062492) macrophage stimulating 1 receptor (c-met-related tyrosine kinase)
dog(444854) macrophage stimulating 1 receptor (c-met-related tyrosine kinase)
sheep(101116433) macrophage stimulating 1 receptor (c-met-related tyrosine kinase)
naked mole-rat(101720807) macrophage stimulating 1 receptor (c-met-related tyrosine kinase)
domestic guinea pig(100732415) macrophage stimulating 1 receptor (c-met-related tyrosine kinase)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
M7072 Anti-MST1R (1096-1110) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
M7197 Anti-MST1R (1376-1390) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB1412194 ANTI-MST1R antibody produced in mouse clone 1H7, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1412195 ANTI-MST1R antibody produced in mouse clone 2F3, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1412196 ANTI-MST1R antibody produced in mouse clone 3H2, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
HPA007657 Anti-MST1R antibody produced in rabbit Ab1, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB4200551 Anti-MST1R antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody rat, human
western blot pricing
HPA008180 Anti-MST1R antibody produced in rabbit Ab2, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB4504130 Anti-phospho-CD136/RON (pSer1394) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, western blot pricing
SAB1305346 ANTI-RON antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing
SAB1305345 ANTI-RON antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
WH0004486M4 Monoclonal Anti-MST1R antibody produced in mouse clone 4E2, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1404086 Monoclonal Anti-MST1R antibody produced in mouse clone 1H8, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB5300420 Monoclonal Anti-MST1R antibody produced in mouse clone 1B5A9, ascites fluid human
ELISA, western blot pricing
AMAB90766 Monoclonal Anti-MST1R antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL0463, purified immunoglobulin, buffered aqueous glycerol solution human
western blot pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
T5568 Tyrphostin AG 835 ≥92% human pricing
T5318 Tyrphostin AG 808 ≥98% human, mouse pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002447 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002447 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002447 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009074 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009074 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009074 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002447 Rosetta Predictions human pricing
NM_001106855 Rosetta Predictions rat pricing
NM_009074 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002447 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00163365 predicted 813
2 SASI_Hs01_00163366 predicted 1589
3 SASI_Hs01_00163367 predicted 3685
4 SASI_Hs01_00163368 predicted 3058
5 SASI_Hs01_00163369 predicted 4036
6 SASI_Hs01_00163370 predicted 2898
7 SASI_Hs01_00163371 predicted 907
8 SASI_Hs01_00163372 predicted 1710
9 SASI_Hs01_00163373 predicted 3541
10 SASI_Hs01_00163374 predicted 1369
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106855 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00223066 predicted 2085
2 SASI_Rn02_00223067 predicted 3614
3 SASI_Rn02_00223068 predicted 2468
4 SASI_Rn02_00223069 predicted 1415
5 SASI_Rn02_00223070 predicted 1757
6 SASI_Rn02_00223071 predicted 1424
7 SASI_Rn02_00223072 predicted 354
8 SASI_Rn02_00223073 predicted 1811
9 SASI_Rn02_00223074 predicted 660
10 SASI_Rn02_00223075 predicted 2976
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009074 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00031793 predicted 916
2 SASI_Mm02_00315260 predicted 866
3 SASI_Mm01_00031794 predicted 1535
4 SASI_Mm01_00031795 predicted 4418
5 SASI_Mm01_00031796 predicted 2348
6 SASI_Mm01_00031797 predicted 1678
7 SASI_Mm01_00031798 predicted 1402
8 SASI_Mm01_00031799 predicted 3666
9 SASI_Mm01_00031800 predicted 3840
10 SASI_Mm01_00031801 predicted 4118
11 SASI_Mm01_00031802 predicted 1759
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002447
VALIDATED
MST1R MISSION shRNA Bacterial Glycerol Stock
macrophage stimulating 1 receptor (c-met-related tyrosine kinase)
Human
29 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000379811    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002447.2-4556s21c1
Sequence:GTACCGGCACCTTGTTCCTGCCCTTTAACTCGAGTTAAAGGGCAGGAACAAGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002447.2-2633s21c1
Sequence:CCGGGCCAGCATCTAACTTCAGCATCTCGAGATGCTGAAGTTAGATGCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002447.2-2899s21c1
Sequence:CCGGGCCATTAAGTTTGAGTATATTCTCGAGAATATACTCAAACTTAATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002447.2-3693s21c1
Sequence:CCGGGCTGGCTCTCATTGGTATCATCTCGAGATGATACCAATGAGAGCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002447.2-3592s21c1
Sequence:CCGGCAATGTGCCATCAAGTCACTACTCGAGTAGTGACTTGATGGCACATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315132    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002447.2-4578s21c1
Sequence:CCGGTTTCAGAGGCAATAGGTAAATCTCGAGATTTACCTATTGCCTCTGAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_002447.1-1453s1c1
Sequence:CCGGGCTGGTCAGGTCACTAAACTACTCGAGTAGTTTAGTGACCTGACCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_002447.1-3734s1c1
Sequence:CCGGAGGGAGTACTATAGTGTTCAACTCGAGTTGAACACTATAGTACTCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_002447.1-3140s1c1
Sequence:CCGGGCATCCTTCTCCGATAGTGAACTCGAGTTCACTATCGGAGAAGGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_002447.1-2829s1c1
Sequence:CCGGGCGTAGATGGTGAATGTCATACTCGAGTATGACATTCACCATCTACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_002447.1-581s1c1
Sequence:CCGGCGTGTAACTGTGGTTGAGCAACTCGAGTTGCTCAACCACAGTTACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002447.1-922s1c1
Sequence:CCGGCGACTGCAGATTTGCTCCAAACTCGAGTTTGGAGCAAATCTGCAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_002447.1-3356s1c1
Sequence:CCGGCAATGTGCCATCAAGTCACTACTCGAGTAGTGACTTGATGGCACATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002447.1-2660s1c1
Sequence:CCGGCATGCCATTAAGTTTGAGTATCTCGAGATACTCAAACTTAATGGCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_002447.1-2397s1c1
Sequence:CCGGGCCAGCATCTAACTTCAGCATCTCGAGATGCTGAAGTTAGATGCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002447.1-1376s1c1
Sequence:CCGGGCATTGTATGTGACACGCCTTCTCGAGAAGGCGTGTCACATACAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121147    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002447.1-4333s1c1
Sequence:CCGGCCTTTAACTTTCAGAGGCAATCTCGAGATTGCCTCTGAAAGTTAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_002447.1-1463s1c1
Sequence:CCGGTCACTAAACTACTTGCTGTATCTCGAGATACAGCAAGTAGTTTAGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_002447.1-3679s1c1
Sequence:CCGGCGAGTCATTCACAGTCAAGGTCTCGAGACCTTGACTGTGAATGACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002447.x-3339s1c1
Sequence:CCGGAGGCCCAGAATCGAATCCAATCTCGAGATTGGATTCGATTCTGGGCCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_002447.x-609s1c1
Sequence:CCGGCCTCCTATTTCTACGTGGCATCTCGAGATGCCACGTAGAAATAGGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003108    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002447.x-4349s1c1
Sequence:CCGGGCAATAGGTAAATGGGCCCATCTCGAGATGGGCCCATTTACCTATTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_002447.x-3457s1c1
Sequence:CCGGGCTGGCTCTCATTGGTATCATCTCGAGATGATACCAATGAGAGCCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_002447.x-4136s1c1
Sequence:CCGGGAGATGAATGTGCGTCCAGAACTCGAGTTCTGGACGCACATTCATCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_002447.1-2699s1c1
Sequence:CCGGGCTGACTGTGTGGGTATCAACCTCGAGGTTGATACCCACACAGTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_002447.1-3952s1c1
Sequence:CCGGGCCTGAGTATTGCCCTGATTCCTCGAGGAATCAGGGCAATACTCAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002447.1-217s1c1
Sequence:CCGGCGACAGAAATGAGAGTGCTGTCTCGAGACAGCACTCTCATTTCTGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_002447.1-831s1c1
Sequence:CCGGGCGTGACAGATGATCCTAGTGCTCGAGCACTAGGATCATCTGTCACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_002447.1-3500s1c1
Sequence:CCGGCATGTGCTGCTGCCCTATATGCTCGAGCATATAGGGCAGCAGCACATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002447
VALIDATED
MST1R MISSION shRNA shRNA Plasmid DNA
macrophage stimulating 1 receptor (c-met-related tyrosine kinase)
Human
29 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000379811    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002447.2-4556s21c1
Sequence:GTACCGGCACCTTGTTCCTGCCCTTTAACTCGAGTTAAAGGGCAGGAACAAGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002447.2-2633s21c1
Sequence:CCGGGCCAGCATCTAACTTCAGCATCTCGAGATGCTGAAGTTAGATGCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002447.2-2899s21c1
Sequence:CCGGGCCATTAAGTTTGAGTATATTCTCGAGAATATACTCAAACTTAATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002447.2-3693s21c1
Sequence:CCGGGCTGGCTCTCATTGGTATCATCTCGAGATGATACCAATGAGAGCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002447.2-3592s21c1
Sequence:CCGGCAATGTGCCATCAAGTCACTACTCGAGTAGTGACTTGATGGCACATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315132    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002447.2-4578s21c1
Sequence:CCGGTTTCAGAGGCAATAGGTAAATCTCGAGATTTACCTATTGCCTCTGAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_002447.1-1453s1c1
Sequence:CCGGGCTGGTCAGGTCACTAAACTACTCGAGTAGTTTAGTGACCTGACCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_002447.1-3734s1c1
Sequence:CCGGAGGGAGTACTATAGTGTTCAACTCGAGTTGAACACTATAGTACTCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_002447.1-3140s1c1
Sequence:CCGGGCATCCTTCTCCGATAGTGAACTCGAGTTCACTATCGGAGAAGGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_002447.1-2829s1c1
Sequence:CCGGGCGTAGATGGTGAATGTCATACTCGAGTATGACATTCACCATCTACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_002447.1-581s1c1
Sequence:CCGGCGTGTAACTGTGGTTGAGCAACTCGAGTTGCTCAACCACAGTTACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002447.1-922s1c1
Sequence:CCGGCGACTGCAGATTTGCTCCAAACTCGAGTTTGGAGCAAATCTGCAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_002447.1-3356s1c1
Sequence:CCGGCAATGTGCCATCAAGTCACTACTCGAGTAGTGACTTGATGGCACATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002447.1-2660s1c1
Sequence:CCGGCATGCCATTAAGTTTGAGTATCTCGAGATACTCAAACTTAATGGCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_002447.1-2397s1c1
Sequence:CCGGGCCAGCATCTAACTTCAGCATCTCGAGATGCTGAAGTTAGATGCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002447.1-1376s1c1
Sequence:CCGGGCATTGTATGTGACACGCCTTCTCGAGAAGGCGTGTCACATACAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121147    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002447.1-4333s1c1
Sequence:CCGGCCTTTAACTTTCAGAGGCAATCTCGAGATTGCCTCTGAAAGTTAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_002447.1-1463s1c1
Sequence:CCGGTCACTAAACTACTTGCTGTATCTCGAGATACAGCAAGTAGTTTAGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_002447.1-3679s1c1
Sequence:CCGGCGAGTCATTCACAGTCAAGGTCTCGAGACCTTGACTGTGAATGACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002447.x-3339s1c1
Sequence:CCGGAGGCCCAGAATCGAATCCAATCTCGAGATTGGATTCGATTCTGGGCCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_002447.x-609s1c1
Sequence:CCGGCCTCCTATTTCTACGTGGCATCTCGAGATGCCACGTAGAAATAGGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003108    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002447.x-4349s1c1
Sequence:CCGGGCAATAGGTAAATGGGCCCATCTCGAGATGGGCCCATTTACCTATTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_002447.x-3457s1c1
Sequence:CCGGGCTGGCTCTCATTGGTATCATCTCGAGATGATACCAATGAGAGCCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_002447.x-4136s1c1
Sequence:CCGGGAGATGAATGTGCGTCCAGAACTCGAGTTCTGGACGCACATTCATCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_002447.1-2699s1c1
Sequence:CCGGGCTGACTGTGTGGGTATCAACCTCGAGGTTGATACCCACACAGTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_002447.1-3952s1c1
Sequence:CCGGGCCTGAGTATTGCCCTGATTCCTCGAGGAATCAGGGCAATACTCAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002447.1-217s1c1
Sequence:CCGGCGACAGAAATGAGAGTGCTGTCTCGAGACAGCACTCTCATTTCTGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_002447.1-831s1c1
Sequence:CCGGGCGTGACAGATGATCCTAGTGCTCGAGCACTAGGATCATCTGTCACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_002447.1-3500s1c1
Sequence:CCGGCATGTGCTGCTGCCCTATATGCTCGAGCATATAGGGCAGCAGCACATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002447
VALIDATED
MST1R MISSION shRNA Lentiviral Transduction Particles
macrophage stimulating 1 receptor (c-met-related tyrosine kinase)
Human
29 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000379811    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002447.2-4556s21c1
Sequence:GTACCGGCACCTTGTTCCTGCCCTTTAACTCGAGTTAAAGGGCAGGAACAAGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002447.2-2633s21c1
Sequence:CCGGGCCAGCATCTAACTTCAGCATCTCGAGATGCTGAAGTTAGATGCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002447.2-2899s21c1
Sequence:CCGGGCCATTAAGTTTGAGTATATTCTCGAGAATATACTCAAACTTAATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002447.2-3693s21c1
Sequence:CCGGGCTGGCTCTCATTGGTATCATCTCGAGATGATACCAATGAGAGCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002447.2-3592s21c1
Sequence:CCGGCAATGTGCCATCAAGTCACTACTCGAGTAGTGACTTGATGGCACATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315132    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002447.2-4578s21c1
Sequence:CCGGTTTCAGAGGCAATAGGTAAATCTCGAGATTTACCTATTGCCTCTGAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_002447.1-1453s1c1
Sequence:CCGGGCTGGTCAGGTCACTAAACTACTCGAGTAGTTTAGTGACCTGACCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_002447.1-3734s1c1
Sequence:CCGGAGGGAGTACTATAGTGTTCAACTCGAGTTGAACACTATAGTACTCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_002447.1-3140s1c1
Sequence:CCGGGCATCCTTCTCCGATAGTGAACTCGAGTTCACTATCGGAGAAGGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_002447.1-2829s1c1
Sequence:CCGGGCGTAGATGGTGAATGTCATACTCGAGTATGACATTCACCATCTACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_002447.1-581s1c1
Sequence:CCGGCGTGTAACTGTGGTTGAGCAACTCGAGTTGCTCAACCACAGTTACACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002447.1-922s1c1
Sequence:CCGGCGACTGCAGATTTGCTCCAAACTCGAGTTTGGAGCAAATCTGCAGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_002447.1-3356s1c1
Sequence:CCGGCAATGTGCCATCAAGTCACTACTCGAGTAGTGACTTGATGGCACATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002447.1-2660s1c1
Sequence:CCGGCATGCCATTAAGTTTGAGTATCTCGAGATACTCAAACTTAATGGCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_002447.1-2397s1c1
Sequence:CCGGGCCAGCATCTAACTTCAGCATCTCGAGATGCTGAAGTTAGATGCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002447.1-1376s1c1
Sequence:CCGGGCATTGTATGTGACACGCCTTCTCGAGAAGGCGTGTCACATACAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121147    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002447.1-4333s1c1
Sequence:CCGGCCTTTAACTTTCAGAGGCAATCTCGAGATTGCCTCTGAAAGTTAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_002447.1-1463s1c1
Sequence:CCGGTCACTAAACTACTTGCTGTATCTCGAGATACAGCAAGTAGTTTAGTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_002447.1-3679s1c1
Sequence:CCGGCGAGTCATTCACAGTCAAGGTCTCGAGACCTTGACTGTGAATGACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002447.x-3339s1c1
Sequence:CCGGAGGCCCAGAATCGAATCCAATCTCGAGATTGGATTCGATTCTGGGCCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_002447.x-609s1c1
Sequence:CCGGCCTCCTATTTCTACGTGGCATCTCGAGATGCCACGTAGAAATAGGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003108    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002447.x-4349s1c1
Sequence:CCGGGCAATAGGTAAATGGGCCCATCTCGAGATGGGCCCATTTACCTATTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_002447.x-3457s1c1
Sequence:CCGGGCTGGCTCTCATTGGTATCATCTCGAGATGATACCAATGAGAGCCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_002447.x-4136s1c1
Sequence:CCGGGAGATGAATGTGCGTCCAGAACTCGAGTTCTGGACGCACATTCATCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_002447.1-2699s1c1
Sequence:CCGGGCTGACTGTGTGGGTATCAACCTCGAGGTTGATACCCACACAGTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_002447.1-3952s1c1
Sequence:CCGGGCCTGAGTATTGCCCTGATTCCTCGAGGAATCAGGGCAATACTCAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002447.1-217s1c1
Sequence:CCGGCGACAGAAATGAGAGTGCTGTCTCGAGACAGCACTCTCATTTCTGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_002447.1-831s1c1
Sequence:CCGGGCGTGACAGATGATCCTAGTGCTCGAGCACTAGGATCATCTGTCACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_002447.1-3500s1c1
Sequence:CCGGCATGTGCTGCTGCCCTATATGCTCGAGCATATAGGGCAGCAGCACATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009074
MST1R MISSION shRNA Bacterial Glycerol Stock
macrophage stimulating 1 receptor (c-met-related tyrosine kinase)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000361459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009074.2-1392s21c1
Sequence:CCGGTTGAAGAGGGTGTCGAATATTCTCGAGAATATTCGACACCCTCTTCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009074.2-3469s21c1
Sequence:CCGGTGTTGTCTACCACGGAGAATACTCGAGTATTCTCCGTGGTAGACAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009074.2-2448s21c1
Sequence:CCGGTCAATGAGGAGCAGATCTTATCTCGAGATAAGATCTGCTCCTCATTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009074.2-904s21c1
Sequence:CCGGGGTGTCCATCCGTCGTCTAAACTCGAGTTTAGACGACGGATGGACACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009074.1-2746s1c1
Sequence:CCGGGCCTGAATATGTGGTCCGAAACTCGAGTTTCGGACCACATATTCAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009074.1-3192s1c1
Sequence:CCGGCCCTGATCTTTAACTCCCGAACTCGAGTTCGGGAGTTAAAGATCAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009074.1-1708s1c1
Sequence:CCGGCCTGCTGTATGTGTCCAACTTCTCGAGAAGTTGGACACATACAGCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009074.1-3883s1c1
Sequence:CCGGCGTCCTAGACAAGGAATACTACTCGAGTAGTATTCCTTGTCTAGGACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009074.1-440s1c1
Sequence:CCGGGCCTACGAGGACAGTACAAATCTCGAGATTTGTACTGTCCTCGTAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009074
MST1R MISSION shRNA shRNA Plasmid DNA
macrophage stimulating 1 receptor (c-met-related tyrosine kinase)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000361459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009074.2-1392s21c1
Sequence:CCGGTTGAAGAGGGTGTCGAATATTCTCGAGAATATTCGACACCCTCTTCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009074.2-3469s21c1
Sequence:CCGGTGTTGTCTACCACGGAGAATACTCGAGTATTCTCCGTGGTAGACAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009074.2-2448s21c1
Sequence:CCGGTCAATGAGGAGCAGATCTTATCTCGAGATAAGATCTGCTCCTCATTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009074.2-904s21c1
Sequence:CCGGGGTGTCCATCCGTCGTCTAAACTCGAGTTTAGACGACGGATGGACACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009074.1-2746s1c1
Sequence:CCGGGCCTGAATATGTGGTCCGAAACTCGAGTTTCGGACCACATATTCAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009074.1-3192s1c1
Sequence:CCGGCCCTGATCTTTAACTCCCGAACTCGAGTTCGGGAGTTAAAGATCAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009074.1-1708s1c1
Sequence:CCGGCCTGCTGTATGTGTCCAACTTCTCGAGAAGTTGGACACATACAGCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009074.1-3883s1c1
Sequence:CCGGCGTCCTAGACAAGGAATACTACTCGAGTAGTATTCCTTGTCTAGGACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009074.1-440s1c1
Sequence:CCGGGCCTACGAGGACAGTACAAATCTCGAGATTTGTACTGTCCTCGTAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009074
MST1R MISSION shRNA Lentiviral Transduction Particles
macrophage stimulating 1 receptor (c-met-related tyrosine kinase)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000361459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009074.2-1392s21c1
Sequence:CCGGTTGAAGAGGGTGTCGAATATTCTCGAGAATATTCGACACCCTCTTCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009074.2-3469s21c1
Sequence:CCGGTGTTGTCTACCACGGAGAATACTCGAGTATTCTCCGTGGTAGACAACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009074.2-2448s21c1
Sequence:CCGGTCAATGAGGAGCAGATCTTATCTCGAGATAAGATCTGCTCCTCATTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009074.2-904s21c1
Sequence:CCGGGGTGTCCATCCGTCGTCTAAACTCGAGTTTAGACGACGGATGGACACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009074.1-2746s1c1
Sequence:CCGGGCCTGAATATGTGGTCCGAAACTCGAGTTTCGGACCACATATTCAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009074.1-3192s1c1
Sequence:CCGGCCCTGATCTTTAACTCCCGAACTCGAGTTCGGGAGTTAAAGATCAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009074.1-1708s1c1
Sequence:CCGGCCTGCTGTATGTGTCCAACTTCTCGAGAAGTTGGACACATACAGCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009074.1-3883s1c1
Sequence:CCGGCGTCCTAGACAAGGAATACTACTCGAGTAGTATTCCTTGTCTAGGACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009074.1-440s1c1
Sequence:CCGGGCCTACGAGGACAGTACAAATCTCGAGATTTGTACTGTCCTCGTAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)