EMAIL THIS PAGE TO A FRIEND

MST4

174 Gene Product Result for
Synonyms: MASK
UniProtKB ID: Q9P289, B2RAU2, Q3ZB77, Q8NC04, Q9BXC3, Q9BXC4
Gene ID:
Human(51765) Summary: The product of this gene is a member of the GCK group III family of kinases, which are a subset of the Ste20-like kinases. The encoded protein contains an amino-terminal kinase domain, and a carboxy-terminal regulatory domain that mediates homodimerization. The protein kinase localizes to the Golgi apparatus and is specifically activated by binding to the Golgi matrix protein GM130. It is also cleaved by caspase-3 in vitro, and may function in the apoptotic pathway. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Jul 2008]
Rat(317589) serine/threonine protein kinase MST4
Zebrafish(100151762) serine/threonine protein kinase MST4
chicken(422231) serine/threonine protein kinase MST4
Horse(100057553) serine/threonine protein kinase MST4
cow(539445) serine/threonine protein kinase MST4
dog(492140) serine/threonine protein kinase MST4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
M7322 Anti-MST4 (312-325) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
M7447 Anti-MST4 (366-380) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB4301214 Anti-MST4 antibody produced in rabbit affinity isolated antibody mouse, human
western blot pricing
SAB2500894 Anti-RP6-213H19.1 antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing
SAB1407522 Anti-RP6-213H19.1 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB1410951 Anti-RP6-213H19.1 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
western blot pricing
HPA059921 Anti-STK26 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
WH0051765M1 Monoclonal Anti-RP6-213H19.1 antibody produced in mouse clone 2G6, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1409433 Monoclonal Anti-RP6-213H19.1 antibody produced in mouse clone 3G5, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB1405110 Monoclonal Anti-RP6-213H19.1, (C-terminal) antibody produced in mouse clone 7H4, purified immunoglobulin, buffered aqueous solution human, rat
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016542 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016542 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016542 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU082081 MISSION® esiRNA esiRNA human RP6-213H19.1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001042452 Rosetta Predictions human pricing
NM_001042453 Rosetta Predictions human pricing
NM_016542 siRNAs that have been validated in the lab human pricing
XM_001070192 Rosetta Predictions rat pricing
XM_229143 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042452 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00309858 predicted 846
2 SASI_Hs02_00309859 predicted 1126
3 SASI_Hs02_00309860 predicted 930
4 SASI_Hs02_00309861 predicted 1113
5 SASI_Hs02_00309862 predicted 1121
6 SASI_Hs02_00309863 predicted 865
7 SASI_Hs02_00309864 predicted 948
8 SASI_Hs02_00309865 predicted 815
9 SASI_Hs02_00309866 predicted 934
10 SASI_Hs02_00309867 predicted 1145
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042453 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00309868 predicted 1088
2 SASI_Hs02_00309869 predicted 1366
3 SASI_Hs02_00309870 predicted 1178
4 SASI_Hs02_00309871 predicted 1360
5 SASI_Hs02_00309872 predicted 1367
6 SASI_Hs02_00309873 predicted 1110
7 SASI_Hs02_00309874 predicted 1193
8 SASI_Hs02_00309875 predicted 1065
9 SASI_Hs02_00309876 predicted 1182
10 SASI_Hs02_00309877 predicted 1398
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016542 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00030410 validated 1588
2 SASI_Hs02_00349645 predicted 1320
3 SASI_Hs02_00349646 predicted 1600
4 SASI_Hs02_00349647 predicted 1406
5 SASI_Hs02_00349648 predicted 1597
6 SASI_Hs02_00349649 predicted 1333
7 SASI_Hs01_00030412 predicted 1424
8 SASI_Hs02_00349650 predicted 1287
9 SASI_Hs01_00030413 predicted 1417
10 SASI_Hs02_00349651 predicted 1624
11 SASI_Hs01_00030409 predicted 748
12 SASI_Hs01_00030411 predicted 576
13 SASI_Hs01_00030414 predicted 884
14 SASI_Hs01_00030415 predicted 927
15 SASI_Hs01_00030416 predicted 943
16 SASI_Hs01_00030417 predicted 1133
17 SASI_Hs01_00030418 predicted 839
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001070192 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00330762 predicted 1734
2 SASI_Rn02_00330763 predicted 1742
3 SASI_Rn02_00330764 predicted 1885
4 SASI_Rn02_00330765 predicted 1040
5 SASI_Rn02_00330766 predicted 2000
6 SASI_Rn02_00330767 predicted 1651
7 SASI_Rn02_00330768 predicted 248
8 SASI_Rn02_00330769 predicted 1350
9 SASI_Rn02_00330770 predicted 1695
10 SASI_Rn02_00330771 predicted 1531
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_229143 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00385836 predicted 341
2 SASI_Rn02_00385837 predicted 899
3 SASI_Rn02_00385838 predicted 247
4 SASI_Rn02_00385839 predicted 957
5 SASI_Rn02_00385840 predicted 767
6 SASI_Rn02_00385841 predicted 1102
7 SASI_Rn02_00385842 predicted 1046
8 SASI_Rn02_00385843 predicted 815
9 SASI_Rn02_00385844 predicted 1061
10 SASI_Rn02_00385845 predicted 955
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016542
VALIDATED
MST4 MISSION shRNA Bacterial Glycerol Stock
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000196861    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016542.3-860s1c1
Sequence:CCGGGCTCCTGAAGTTATTCAACAGCTCGAGCTGTTGAATAACTTCAGGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195233    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016542.3-3126s1c1
Sequence:CCGGCAACTCATGTTATGGGTTAAACTCGAGTTTAACCCATAACATGAGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003191    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_016542.x-2102s1c1
Sequence:CCGGCCTCTTGGTGTATAGTATTTACTCGAGTAAATACTATACACCAAGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_016542.x-1310s1c1
Sequence:CCGGCTTAAACAGCAGGACGAGAATCTCGAGATTCTCGTCCTGCTGTTTAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_016542.x-996s1c1
Sequence:CCGGCATCATTTCGTCCTACAGCAACTCGAGTTGCTGTAGGACGAAATGATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_016542.x-577s1c1
Sequence:CCGGCCAGATTGCTACCATGCTAAACTCGAGTTTAGCATGGTAGCAATCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_016542.x-1220s1c1
Sequence:CCGGGATCCAAAGAAAGTACAGAATCTCGAGATTCTGTACTTTCTTTGGATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016542.3-911s21c1
Sequence:CCGGTCATTGGGAATTACTGCTATTCTCGAGAATAGCAGTAATTCCCAATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320745    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016542.3-2182s21c1
Sequence:CCGGCCTCTTGGTGTATAGTATTTACTCGAGTAAATACTATACACCAAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016542.3-658s21c1
Sequence:CCGGCCAGATTGCTACCATGCTAAACTCGAGTTTAGCATGGTAGCAATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016542.3-1301s21c1
Sequence:CCGGGATCCAAAGAAAGTACAGAATCTCGAGATTCTGTACTTTCTTTGGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016542.3-1391s21c1
Sequence:CCGGCTTAAACAGCAGGACGAGAATCTCGAGATTCTCGTCCTGCTGTTTAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016542
VALIDATED
MST4 MISSION shRNA shRNA Plasmid DNA
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000196861    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016542.3-860s1c1
Sequence:CCGGGCTCCTGAAGTTATTCAACAGCTCGAGCTGTTGAATAACTTCAGGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195233    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016542.3-3126s1c1
Sequence:CCGGCAACTCATGTTATGGGTTAAACTCGAGTTTAACCCATAACATGAGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003191    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_016542.x-2102s1c1
Sequence:CCGGCCTCTTGGTGTATAGTATTTACTCGAGTAAATACTATACACCAAGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_016542.x-1310s1c1
Sequence:CCGGCTTAAACAGCAGGACGAGAATCTCGAGATTCTCGTCCTGCTGTTTAAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_016542.x-996s1c1
Sequence:CCGGCATCATTTCGTCCTACAGCAACTCGAGTTGCTGTAGGACGAAATGATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_016542.x-577s1c1
Sequence:CCGGCCAGATTGCTACCATGCTAAACTCGAGTTTAGCATGGTAGCAATCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_016542.x-1220s1c1
Sequence:CCGGGATCCAAAGAAAGTACAGAATCTCGAGATTCTGTACTTTCTTTGGATCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016542.3-911s21c1
Sequence:CCGGTCATTGGGAATTACTGCTATTCTCGAGAATAGCAGTAATTCCCAATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320745    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016542.3-2182s21c1
Sequence:CCGGCCTCTTGGTGTATAGTATTTACTCGAGTAAATACTATACACCAAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016542.3-658s21c1
Sequence:CCGGCCAGATTGCTACCATGCTAAACTCGAGTTTAGCATGGTAGCAATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016542.3-1301s21c1
Sequence:CCGGGATCCAAAGAAAGTACAGAATCTCGAGATTCTGTACTTTCTTTGGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016542.3-1391s21c1
Sequence:CCGGCTTAAACAGCAGGACGAGAATCTCGAGATTCTCGTCCTGCTGTTTAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016542
VALIDATED
MST4 MISSION shRNA Lentiviral Transduction Particles
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000196861    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016542.3-860s1c1
Sequence:CCGGGCTCCTGAAGTTATTCAACAGCTCGAGCTGTTGAATAACTTCAGGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195233    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016542.3-3126s1c1
Sequence:CCGGCAACTCATGTTATGGGTTAAACTCGAGTTTAACCCATAACATGAGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003191    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_016542.x-2102s1c1
Sequence:CCGGCCTCTTGGTGTATAGTATTTACTCGAGTAAATACTATACACCAAGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_016542.x-1310s1c1
Sequence:CCGGCTTAAACAGCAGGACGAGAATCTCGAGATTCTCGTCCTGCTGTTTAAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_016542.x-996s1c1
Sequence:CCGGCATCATTTCGTCCTACAGCAACTCGAGTTGCTGTAGGACGAAATGATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_016542.x-577s1c1
Sequence:CCGGCCAGATTGCTACCATGCTAAACTCGAGTTTAGCATGGTAGCAATCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_016542.x-1220s1c1
Sequence:CCGGGATCCAAAGAAAGTACAGAATCTCGAGATTCTGTACTTTCTTTGGATCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016542.3-911s21c1
Sequence:CCGGTCATTGGGAATTACTGCTATTCTCGAGAATAGCAGTAATTCCCAATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320745    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016542.3-2182s21c1
Sequence:CCGGCCTCTTGGTGTATAGTATTTACTCGAGTAAATACTATACACCAAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016542.3-658s21c1
Sequence:CCGGCCAGATTGCTACCATGCTAAACTCGAGTTTAGCATGGTAGCAATCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016542.3-1301s21c1
Sequence:CCGGGATCCAAAGAAAGTACAGAATCTCGAGATTCTGTACTTTCTTTGGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016542.3-1391s21c1
Sequence:CCGGCTTAAACAGCAGGACGAGAATCTCGAGATTCTCGTCCTGCTGTTTAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)