EMAIL THIS PAGE TO A FRIEND

MSTN

myostatin

172 Gene Product Result for
Synonyms: GDF8 MSLHP
UniProtKB ID: O14793, A1C2J7, A1C2K0, Q6B0H2
Gene ID:
Human(2660) Summary: The protein encoded by this gene is a member of the bone morphogenetic protein (BMP) family and the TGF-beta superfamily. This group of proteins is characterized by a polybasic proteolytic processing site which is cleaved to produce a mature protein containing seven conserved cysteine residues. The members of this family are regulators of cell growth and differentiation in both embryonic and adult tissues. This gene is thought to encode a secreted protein which negatively regulates skeletal muscle growth. [provided by RefSeq, Jul 2008]
Mouse(17700) myostatin
Rat(29152) myostatin
Goat(100860887) myostatin
sheep(443449) myostatin
chicken(373964) myostatin
cow(281187) myostatin
Horse(100033832) myostatin
dog(403433) myostatin
Gene Class: Calcium_Binding
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005259 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005259 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005259 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010834 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010834 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010834 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU041671 MISSION® esiRNA esiRNA human MSTN (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005259 Rosetta Predictions human pricing
NM_019151 Rosetta Predictions rat pricing
NM_010834 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005259 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00080236 predicted 1045 140.00
2 SASI_Hs01_00080237 predicted 812 140.00
3 SASI_Hs01_00080238 predicted 348 140.00
4 SASI_Hs01_00080239 predicted 957 140.00
5 SASI_Hs01_00080240 predicted 440 140.00
6 SASI_Hs01_00080241 predicted 668 140.00
7 SASI_Hs01_00080242 predicted 770 140.00
8 SASI_Hs01_00080243 predicted 309 140.00
9 SASI_Hs01_00080244 predicted 1163 140.00
10 SASI_Hs01_00080245 predicted 968 140.00
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019151 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00095562 predicted 215 140.00
2 SASI_Rn01_00095563 predicted 645 140.00
3 SASI_Rn01_00095564 predicted 595 140.00
4 SASI_Rn01_00095565 predicted 658 140.00
5 SASI_Rn01_00095566 predicted 464 140.00
6 SASI_Rn01_00095567 predicted 533 140.00
7 SASI_Rn01_00095568 predicted 666 140.00
8 SASI_Rn01_00095569 predicted 498 140.00
9 SASI_Rn01_00095570 predicted 546 140.00
10 SASI_Rn01_00095571 predicted 492 140.00
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010834 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00101296 predicted 307 140.00
2 SASI_Mm01_00101297 predicted 1143 140.00
3 SASI_Mm01_00101298 predicted 747 140.00
4 SASI_Mm01_00101299 predicted 567 140.00
5 SASI_Mm02_00319464 predicted 787 140.00
6 SASI_Mm01_00101301 predicted 699 140.00
7 SASI_Mm01_00101302 predicted 645 140.00
8 SASI_Mm01_00101303 predicted 416 140.00
9 SASI_Mm01_00101304 predicted 977 140.00
10 SASI_Mm01_00101305 predicted 712 140.00
11 SASI_Mm01_00101300 predicted 991 140.00
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005259
MSTN MISSION shRNA Bacterial Glycerol Stock
myostatin
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000373073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005259.2-591s21c1
Sequence:CCGGAGGCCCAACTATGGATATATTCTCGAGAATATATCCATAGTTGGGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005259.1-1019s1c1
Sequence:CCGGGATTGGATTATCGCTCCTAAACTCGAGTTTAGGAGCGATAATCCAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005259.1-1157s1c1
Sequence:CCGGCCCACAAAGATGTCTCCAATTCTCGAGAATTGGAGACATCTTTGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005259.1-652s1c1
Sequence:CCGGCCTGAGACTCATCAAACCTATCTCGAGATAGGTTTGATGAGTCTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005259.1-700s1c1
Sequence:CCGGCCGATCTCTGAAACTTGACATCTCGAGATGTCAAGTTTCAGAGATCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005259.1-788s1c1
Sequence:CCGGCCTGAATCCAACTTAGGCATTCTCGAGAATGCCTAAGTTGGATTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373019    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005259.2-1583s21c1
Sequence:CCGGGTATGCTTTAAAGTCTATTTCCTCGAGGAAATAGACTTTAAAGCATACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373020    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005259.2-1485s21c1
Sequence:CCGGGAGCTAGAAGGAGATCAAATTCTCGAGAATTTGATCTCCTTCTAGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005259
MSTN MISSION shRNA shRNA Plasmid DNA
myostatin
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000373073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005259.2-591s21c1
Sequence:CCGGAGGCCCAACTATGGATATATTCTCGAGAATATATCCATAGTTGGGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005259.1-1019s1c1
Sequence:CCGGGATTGGATTATCGCTCCTAAACTCGAGTTTAGGAGCGATAATCCAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005259.1-1157s1c1
Sequence:CCGGCCCACAAAGATGTCTCCAATTCTCGAGAATTGGAGACATCTTTGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005259.1-652s1c1
Sequence:CCGGCCTGAGACTCATCAAACCTATCTCGAGATAGGTTTGATGAGTCTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005259.1-700s1c1
Sequence:CCGGCCGATCTCTGAAACTTGACATCTCGAGATGTCAAGTTTCAGAGATCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005259.1-788s1c1
Sequence:CCGGCCTGAATCCAACTTAGGCATTCTCGAGAATGCCTAAGTTGGATTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373019    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005259.2-1583s21c1
Sequence:CCGGGTATGCTTTAAAGTCTATTTCCTCGAGGAAATAGACTTTAAAGCATACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373020    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005259.2-1485s21c1
Sequence:CCGGGAGCTAGAAGGAGATCAAATTCTCGAGAATTTGATCTCCTTCTAGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005259
MSTN MISSION shRNA Lentiviral Transduction Particles
myostatin
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000373073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005259.2-591s21c1
Sequence:CCGGAGGCCCAACTATGGATATATTCTCGAGAATATATCCATAGTTGGGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005259.1-1019s1c1
Sequence:CCGGGATTGGATTATCGCTCCTAAACTCGAGTTTAGGAGCGATAATCCAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005259.1-1157s1c1
Sequence:CCGGCCCACAAAGATGTCTCCAATTCTCGAGAATTGGAGACATCTTTGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005259.1-652s1c1
Sequence:CCGGCCTGAGACTCATCAAACCTATCTCGAGATAGGTTTGATGAGTCTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005259.1-700s1c1
Sequence:CCGGCCGATCTCTGAAACTTGACATCTCGAGATGTCAAGTTTCAGAGATCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005259.1-788s1c1
Sequence:CCGGCCTGAATCCAACTTAGGCATTCTCGAGAATGCCTAAGTTGGATTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373019    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005259.2-1583s21c1
Sequence:CCGGGTATGCTTTAAAGTCTATTTCCTCGAGGAAATAGACTTTAAAGCATACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373020    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005259.2-1485s21c1
Sequence:CCGGGAGCTAGAAGGAGATCAAATTCTCGAGAATTTGATCTCCTTCTAGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010834
MSTN MISSION shRNA Bacterial Glycerol Stock
myostatin
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000030554    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010834.1-1322s1c1
Sequence:CCGGGCCTTGAGTATGCTCTAGTAACTCGAGTTACTAGAGCATACTCAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010834.1-311s1c1
Sequence:CCGGGCTCCTAACATCAGCAAAGATCTCGAGATCTTTGCTGATGTTAGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010834.1-981s1c1
Sequence:CCGGCCTTTGGATGGGACTGGATTACTCGAGTAATCCAGTCCCATCCAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010834.1-702s1c1
Sequence:CCGGGCACTGGTATTTGGCAGAGTACTCGAGTACTCTGCCAAATACCAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010834.1-417s1c1
Sequence:CCGGGCTCTTTGGAAGATGACGATTCTCGAGAATCGTCATCTTCCAAAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010834
MSTN MISSION shRNA shRNA Plasmid DNA
myostatin
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000030554    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010834.1-1322s1c1
Sequence:CCGGGCCTTGAGTATGCTCTAGTAACTCGAGTTACTAGAGCATACTCAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000030556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010834.1-311s1c1
Sequence:CCGGGCTCCTAACATCAGCAAAGATCTCGAGATCTTTGCTGATGTTAGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000030557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010834.1-981s1c1
Sequence:CCGGCCTTTGGATGGGACTGGATTACTCGAGTAATCCAGTCCCATCCAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000030555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010834.1-702s1c1
Sequence:CCGGGCACTGGTATTTGGCAGAGTACTCGAGTACTCTGCCAAATACCAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000030558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010834.1-417s1c1
Sequence:CCGGGCTCTTTGGAAGATGACGATTCTCGAGAATCGTCATCTTCCAAAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010834
MSTN MISSION shRNA Lentiviral Transduction Particles
myostatin
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000030554    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010834.1-1322s1c1
Sequence:CCGGGCCTTGAGTATGCTCTAGTAACTCGAGTTACTAGAGCATACTCAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010834.1-311s1c1
Sequence:CCGGGCTCCTAACATCAGCAAAGATCTCGAGATCTTTGCTGATGTTAGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010834.1-981s1c1
Sequence:CCGGCCTTTGGATGGGACTGGATTACTCGAGTAATCCAGTCCCATCCAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010834.1-702s1c1
Sequence:CCGGGCACTGGTATTTGGCAGAGTACTCGAGTACTCTGCCAAATACCAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010834.1-417s1c1
Sequence:CCGGGCTCTTTGGAAGATGACGATTCTCGAGAATCGTCATCTTCCAAAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)