EMAIL THIS PAGE TO A FRIEND

MSTO1

misato 1, mitochondrial distribution and morphology regulator

78 Gene Product Result for
Synonyms: MST
Gene ID:
Mouse(229524) misato homolog 1 (Drosophila)
Rat(295237) misato homolog 1 (Drosophila)
Zebrafish(334306) misato homolog 1 (Drosophila)
cow(535567) misato homolog 1 (Drosophila)
domestic cat(101087704) misato homolog 1 (Drosophila)
dog(490423) misato homolog 1 (Drosophila)
chicken(425066) misato homolog 1 (Drosophila)
naked mole-rat(101725678) misato homolog 1 (Drosophila)
Domestic Rabbit(100352018) misato homolog 1 (Drosophila)
domestic guinea pig(100734373) misato homolog 1 (Drosophila)
sheep(101120534) misato homolog 1 (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018116 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018116 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018116 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_144898 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144898 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144898 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018116 Rosetta Predictions human pricing
NM_001106443 Rosetta Predictions rat pricing
NM_144898 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018116 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00101495 predicted 1182
2 SASI_Hs01_00101496 predicted 850
3 SASI_Hs01_00101497 predicted 366
4 SASI_Hs01_00101498 predicted 276
5 SASI_Hs01_00101499 predicted 246
6 SASI_Hs01_00101500 predicted 352
7 SASI_Hs02_00351323 predicted 643
8 SASI_Hs01_00101501 predicted 346
9 SASI_Hs01_00101502 predicted 867
10 SASI_Hs01_00101503 predicted 334
11 SASI_Hs01_00101504 predicted 693
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106443 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00219008 predicted 724
2 SASI_Rn02_00219009 predicted 234
3 SASI_Rn02_00219010 predicted 1064
4 SASI_Rn02_00219011 predicted 658
5 SASI_Rn02_00219012 predicted 867
6 SASI_Rn02_00219013 predicted 748
7 SASI_Rn02_00219014 predicted 1427
8 SASI_Rn02_00219015 predicted 739
9 SASI_Rn02_00219016 predicted 255
10 SASI_Rn02_00219017 predicted 843
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144898 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00179351 predicted 1349
2 SASI_Mm01_00179352 predicted 1310
3 SASI_Mm01_00179353 predicted 849
4 SASI_Mm01_00179354 predicted 1413
5 SASI_Mm01_00179355 predicted 721
6 SASI_Mm02_00340357 predicted 471
7 SASI_Mm01_00179357 predicted 331
8 SASI_Mm01_00179358 predicted 1019
9 SASI_Mm01_00179359 predicted 237
10 SASI_Mm01_00179360 predicted 931
11 SASI_Mm01_00179356 predicted 226
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018116
MSTO1 MISSION shRNA Bacterial Glycerol Stock
misato 1, mitochondrial distribution and morphology regulator
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000122232    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018116.2-1960s1c1
Sequence:CCGGGATGCTACTTACAGAGGACATCTCGAGATGTCCTCTGTAAGTAGCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018116.2-1372s1c1
Sequence:CCGGGAAGAAATCTTGGCTCAGTATCTCGAGATACTGAGCCAAGATTTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142028    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018116.2-769s1c1
Sequence:CCGGGCAGAGCTGCTACAAGATGAACTCGAGTTCATCTTGTAGCAGCTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018116.2-1055s1c1
Sequence:CCGGCTGTTCCTTATCGCCTGTGTTCTCGAGAACACAGGCGATAAGGAACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018116.2-555s1c1
Sequence:CCGGCCGGAGCATCTGTATGATTCACTCGAGTGAATCATACAGATGCTCCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018116.2-1186s1c1
Sequence:CCGGCCTGATTCCCTGATGCAGTTTCTCGAGAAACTGCATCAGGGAATCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018116.2-904s21c1
Sequence:CCGGACTGCTCACAGCTCTCTTGTCCTCGAGGACAAGAGAGCTGTGAGCAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018116.2-392s21c1
Sequence:CCGGGTGCAGAGGGAGTGCTGAGTACTCGAGTACTCAGCACTCCCTCTGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018116.2-857s21c1
Sequence:CCGGGAAACATCTATCGTCTATTAACTCGAGTTAATAGACGATAGATGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018116
MSTO1 MISSION shRNA shRNA Plasmid DNA
misato 1, mitochondrial distribution and morphology regulator
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000122232    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018116.2-1960s1c1
Sequence:CCGGGATGCTACTTACAGAGGACATCTCGAGATGTCCTCTGTAAGTAGCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018116.2-1372s1c1
Sequence:CCGGGAAGAAATCTTGGCTCAGTATCTCGAGATACTGAGCCAAGATTTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142028    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018116.2-769s1c1
Sequence:CCGGGCAGAGCTGCTACAAGATGAACTCGAGTTCATCTTGTAGCAGCTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018116.2-1055s1c1
Sequence:CCGGCTGTTCCTTATCGCCTGTGTTCTCGAGAACACAGGCGATAAGGAACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018116.2-555s1c1
Sequence:CCGGCCGGAGCATCTGTATGATTCACTCGAGTGAATCATACAGATGCTCCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018116.2-1186s1c1
Sequence:CCGGCCTGATTCCCTGATGCAGTTTCTCGAGAAACTGCATCAGGGAATCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018116.2-904s21c1
Sequence:CCGGACTGCTCACAGCTCTCTTGTCCTCGAGGACAAGAGAGCTGTGAGCAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018116.2-392s21c1
Sequence:CCGGGTGCAGAGGGAGTGCTGAGTACTCGAGTACTCAGCACTCCCTCTGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018116.2-857s21c1
Sequence:CCGGGAAACATCTATCGTCTATTAACTCGAGTTAATAGACGATAGATGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018116
MSTO1 MISSION shRNA Lentiviral Transduction Particles
misato 1, mitochondrial distribution and morphology regulator
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000122232    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018116.2-1960s1c1
Sequence:CCGGGATGCTACTTACAGAGGACATCTCGAGATGTCCTCTGTAAGTAGCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018116.2-1372s1c1
Sequence:CCGGGAAGAAATCTTGGCTCAGTATCTCGAGATACTGAGCCAAGATTTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142028    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018116.2-769s1c1
Sequence:CCGGGCAGAGCTGCTACAAGATGAACTCGAGTTCATCTTGTAGCAGCTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018116.2-1055s1c1
Sequence:CCGGCTGTTCCTTATCGCCTGTGTTCTCGAGAACACAGGCGATAAGGAACAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018116.2-555s1c1
Sequence:CCGGCCGGAGCATCTGTATGATTCACTCGAGTGAATCATACAGATGCTCCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018116.2-1186s1c1
Sequence:CCGGCCTGATTCCCTGATGCAGTTTCTCGAGAAACTGCATCAGGGAATCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018116.2-904s21c1
Sequence:CCGGACTGCTCACAGCTCTCTTGTCCTCGAGGACAAGAGAGCTGTGAGCAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018116.2-392s21c1
Sequence:CCGGGTGCAGAGGGAGTGCTGAGTACTCGAGTACTCAGCACTCCCTCTGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018116.2-857s21c1
Sequence:CCGGGAAACATCTATCGTCTATTAACTCGAGTTAATAGACGATAGATGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144898
VALIDATED
MSTO1 MISSION shRNA Bacterial Glycerol Stock
misato 1, mitochondrial distribution and morphology regulator
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000192350    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144898.1-1412s1c1
Sequence:CCGGCATACCCACACTTCTTCTCAACTCGAGTTGAGAAGAAGTGTGGGTATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191186    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144898.1-223s1c1
Sequence:CCGGCTCATCCTAATGGATCTGAAACTCGAGTTTCAGATCCATTAGGATGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216995    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144898.1-924s1c1
Sequence:CCGGCAACTTCCCTTCCCTACATTACTCGAGTAATGTAGGGAAGGGAAGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144898.1-51s21c1
Sequence:CCGGCACGCTGCAGTTGGGACATTTCTCGAGAAATGTCCCAACTGCAGCGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144898.1-817s21c1
Sequence:CCGGCGTCTCTTAAACACGGCATTTCTCGAGAAATGCCGTGTTTAAGAGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144898.1-213s21c1
Sequence:CCGGTACGCCTCGACTCATCCTAATCTCGAGATTAGGATGAGTCGAGGCGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144898.1-722s21c1
Sequence:CCGGAGCTACTACAAGACGAGTATGCTCGAGCATACTCGTCTTGTAGTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144898.1-924s21c1
Sequence:CCGGCAACTTCCCTTCCCTACATTACTCGAGTAATGTAGGGAAGGGAAGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144898
VALIDATED
MSTO1 MISSION shRNA shRNA Plasmid DNA
misato 1, mitochondrial distribution and morphology regulator
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000192350    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144898.1-1412s1c1
Sequence:CCGGCATACCCACACTTCTTCTCAACTCGAGTTGAGAAGAAGTGTGGGTATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191186    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144898.1-223s1c1
Sequence:CCGGCTCATCCTAATGGATCTGAAACTCGAGTTTCAGATCCATTAGGATGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216995    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144898.1-924s1c1
Sequence:CCGGCAACTTCCCTTCCCTACATTACTCGAGTAATGTAGGGAAGGGAAGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144898.1-51s21c1
Sequence:CCGGCACGCTGCAGTTGGGACATTTCTCGAGAAATGTCCCAACTGCAGCGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144898.1-817s21c1
Sequence:CCGGCGTCTCTTAAACACGGCATTTCTCGAGAAATGCCGTGTTTAAGAGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144898.1-213s21c1
Sequence:CCGGTACGCCTCGACTCATCCTAATCTCGAGATTAGGATGAGTCGAGGCGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144898.1-722s21c1
Sequence:CCGGAGCTACTACAAGACGAGTATGCTCGAGCATACTCGTCTTGTAGTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144898.1-924s21c1
Sequence:CCGGCAACTTCCCTTCCCTACATTACTCGAGTAATGTAGGGAAGGGAAGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144898
VALIDATED
MSTO1 MISSION shRNA Lentiviral Transduction Particles
misato 1, mitochondrial distribution and morphology regulator
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000192350    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144898.1-1412s1c1
Sequence:CCGGCATACCCACACTTCTTCTCAACTCGAGTTGAGAAGAAGTGTGGGTATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191186    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144898.1-223s1c1
Sequence:CCGGCTCATCCTAATGGATCTGAAACTCGAGTTTCAGATCCATTAGGATGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216995    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144898.1-924s1c1
Sequence:CCGGCAACTTCCCTTCCCTACATTACTCGAGTAATGTAGGGAAGGGAAGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144898.1-51s21c1
Sequence:CCGGCACGCTGCAGTTGGGACATTTCTCGAGAAATGTCCCAACTGCAGCGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144898.1-817s21c1
Sequence:CCGGCGTCTCTTAAACACGGCATTTCTCGAGAAATGCCGTGTTTAAGAGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144898.1-213s21c1
Sequence:CCGGTACGCCTCGACTCATCCTAATCTCGAGATTAGGATGAGTCGAGGCGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144898.1-722s21c1
Sequence:CCGGAGCTACTACAAGACGAGTATGCTCGAGCATACTCGTCTTGTAGTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144898.1-924s21c1
Sequence:CCGGCAACTTCCCTTCCCTACATTACTCGAGTAATGTAGGGAAGGGAAGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)