EMAIL THIS PAGE TO A FRIEND

MSX1

msh homeobox 1

72 Gene Product Result for
Synonyms: ECTD3 HOX7 HYD1 STHAG1
UniProtKB ID: P28360, Q96NY4
Gene ID:
Human(4487) Summary: This gene encodes a member of the muscle segment homeobox gene family. The encoded protein functions as a transcriptional repressor during embryogenesis through interactions with components of the core transcription complex and other homeoproteins. It may also have roles in limb-pattern formation, craniofacial development, particularly odontogenesis, and tumor growth inhibition. Mutations in this gene, which was once known as homeobox 7, have been associated with nonsyndromic cleft lip with or without cleft palate 5, Witkop syndrome, Wolf-Hirschom syndrome, and autosomoal dominant hypodontia. [provided by RefSeq, Jul 2008]
Mouse(17701) msh homeobox 1
Rat(81710) msh homeobox 1
sheep(101114019) msh homeobox 1
naked mole-rat(101706838) msh homeobox 1
chicken(396484) msh homeobox 1
dog(488828) msh homeobox 1
cow(286872) msh homeobox 1
domestic cat(101093268) msh homeobox 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV31396 Anti-MSX1 (AB1) antibody produced in rabbit IgG fraction of antiserum horse, bovine, guinea pig, dog, human, rat
immunohistochemistry, western blot pricing
AV37094 Anti-MSX1 (AB2) antibody produced in rabbit IgG fraction of antiserum bovine, human, mouse, pig, rat, dog
western blot pricing
SAB2500650 Anti-MSX1 antibody produced in goat affinity isolated antibody, buffered aqueous solution rat, human, mouse
ELISA, immunohistochemistry pricing
SAB1412289 ANTI-MSX1 antibody produced in mouse clone 3A8, purified immunoglobulin, buffered aqueous solution human
ELISA, immunoprecipitation (IP) pricing
M0944 Anti-Msx1 antibody produced in rabbit affinity isolated antibody, ammonium sulfate suspension rodent, human
immunohistochemistry, western blot pricing
M6198 Anti-MSX1 antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody, buffered aqueous solution human
immunofluorescence, immunoprecipitation (IP), western blot pricing
HPA063895 Anti-MSX1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing
HPA073604 Anti-MSX1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody Antibody Enhanced Validation human
immunohistochemistry pricing
WH0004487M3 Monoclonal Anti-MSX1 antibody produced in mouse clone 2B12, purified immunoglobulin, buffered aqueous solution human
ELISA, immunoprecipitation (IP) pricing
SAB1404087 Monoclonal Anti-MSX1 antibody produced in mouse clone 1D2, purified immunoglobulin, buffered aqueous solution human
ELISA, immunoprecipitation (IP), western blot pricing
SAB5300418 Monoclonal Anti-MSX1 antibody produced in mouse clone 5D11, ascites fluid human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002448 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002448 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002448 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010835 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010835 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010835 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU147951 MISSION® esiRNA esiRNA human MSX1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002448 Rosetta Predictions human pricing
NM_031059 Rosetta Predictions rat pricing
NM_010835 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002448 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00026187 predicted 609
2 SASI_Hs01_00026188 predicted 1024
3 SASI_Hs01_00026189 predicted 724
4 SASI_Hs01_00026190 predicted 1081
5 SASI_Hs02_00333850 predicted 796
6 SASI_Hs01_00026191 predicted 980
7 SASI_Hs01_00026192 predicted 902
8 SASI_Hs01_00026193 predicted 1028
9 SASI_Hs01_00026194 predicted 971
10 SASI_Hs01_00026195 predicted 1074
11 SASI_Hs01_00026196 predicted 838
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031059 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00264296 predicted 693
2 SASI_Rn01_00059825 predicted 815
3 SASI_Rn01_00059826 predicted 790
4 SASI_Rn01_00059829 predicted 964
5 SASI_Rn01_00059830 predicted 790
6 SASI_Rn01_00059832 predicted 315
7 SASI_Rn01_00059833 predicted 493
8 SASI_Rn02_00264297 predicted 697
9 SASI_Rn01_00059834 predicted 996
10 SASI_Rn02_00264298 predicted 865
11 SASI_Rn01_00059827 predicted 809
12 SASI_Rn01_00059828 predicted 498
13 SASI_Rn01_00059831 predicted 695
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010835 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00154475 predicted 595
2 SASI_Mm02_00319465 predicted 1409
3 SASI_Mm01_00154476 predicted 996
4 SASI_Mm02_00319466 predicted 1099
5 SASI_Mm01_00154477 predicted 730
6 SASI_Mm01_00154478 predicted 773
7 SASI_Mm01_00154479 predicted 607
8 SASI_Mm01_00154480 predicted 1315
9 SASI_Mm01_00154481 predicted 417
10 SASI_Mm01_00154482 predicted 631
11 SASI_Mm01_00154473 predicted 1217
12 SASI_Mm01_00154474 predicted 1263
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002448
VALIDATED
MSX1 MISSION shRNA Bacterial Glycerol Stock
msh homeobox 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000274121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002448.3-908s21c1
Sequence:CCGGGCCAAGGCAAAGAGACTACAACTCGAGTTGTAGTCTCTTTGCCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002448.1-901s1c1
Sequence:CCGGGCAAAGAGACTACAAGAGGCACTCGAGTGCCTCTTGTAGTCTCTTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020414    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002448.1-1415s1c1
Sequence:CCGGCCAGCAGAATTGACAGTTGAACTCGAGTTCAACTGTCAATTCTGCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002448.1-1113s1c1
Sequence:CCGGCAGCATGTACCACCTGACATACTCGAGTATGTCAGGTGGTACATGCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002448.1-723s1c1
Sequence:CCGGCAAACACAAGACGAACCGTAACTCGAGTTACGGTTCGTCTTGTGTTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002448.3-262s21c1
Sequence:CCGGTTTGCCACTCGGTGTCAAAGTCTCGAGACTTTGACACCGAGTGGCAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002448.3-615s21c1
Sequence:CCGGCAGAAGATGCGCTCGTCAAAGCTCGAGCTTTGACGAGCGCATCTTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002448.3-1114s21c1
Sequence:CCGGCCATGTGGGCTACAGCATGTACTCGAGTACATGCTGTAGCCCACATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274118    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002448.3-1340s21c1
Sequence:CCGGTTAGTACTCTTCTAGCATTTACTCGAGTAAATGCTAGAAGAGTACTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002448
VALIDATED
MSX1 MISSION shRNA shRNA Plasmid DNA
msh homeobox 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000274121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002448.3-908s21c1
Sequence:CCGGGCCAAGGCAAAGAGACTACAACTCGAGTTGTAGTCTCTTTGCCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002448.1-901s1c1
Sequence:CCGGGCAAAGAGACTACAAGAGGCACTCGAGTGCCTCTTGTAGTCTCTTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020414    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002448.1-1415s1c1
Sequence:CCGGCCAGCAGAATTGACAGTTGAACTCGAGTTCAACTGTCAATTCTGCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002448.1-1113s1c1
Sequence:CCGGCAGCATGTACCACCTGACATACTCGAGTATGTCAGGTGGTACATGCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002448.1-723s1c1
Sequence:CCGGCAAACACAAGACGAACCGTAACTCGAGTTACGGTTCGTCTTGTGTTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002448.3-262s21c1
Sequence:CCGGTTTGCCACTCGGTGTCAAAGTCTCGAGACTTTGACACCGAGTGGCAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002448.3-615s21c1
Sequence:CCGGCAGAAGATGCGCTCGTCAAAGCTCGAGCTTTGACGAGCGCATCTTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002448.3-1114s21c1
Sequence:CCGGCCATGTGGGCTACAGCATGTACTCGAGTACATGCTGTAGCCCACATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274118    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002448.3-1340s21c1
Sequence:CCGGTTAGTACTCTTCTAGCATTTACTCGAGTAAATGCTAGAAGAGTACTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002448
VALIDATED
MSX1 MISSION shRNA Lentiviral Transduction Particles
msh homeobox 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000274121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002448.3-908s21c1
Sequence:CCGGGCCAAGGCAAAGAGACTACAACTCGAGTTGTAGTCTCTTTGCCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002448.1-901s1c1
Sequence:CCGGGCAAAGAGACTACAAGAGGCACTCGAGTGCCTCTTGTAGTCTCTTTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020414    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002448.1-1415s1c1
Sequence:CCGGCCAGCAGAATTGACAGTTGAACTCGAGTTCAACTGTCAATTCTGCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002448.1-1113s1c1
Sequence:CCGGCAGCATGTACCACCTGACATACTCGAGTATGTCAGGTGGTACATGCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002448.1-723s1c1
Sequence:CCGGCAAACACAAGACGAACCGTAACTCGAGTTACGGTTCGTCTTGTGTTTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002448.3-262s21c1
Sequence:CCGGTTTGCCACTCGGTGTCAAAGTCTCGAGACTTTGACACCGAGTGGCAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002448.3-615s21c1
Sequence:CCGGCAGAAGATGCGCTCGTCAAAGCTCGAGCTTTGACGAGCGCATCTTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002448.3-1114s21c1
Sequence:CCGGCCATGTGGGCTACAGCATGTACTCGAGTACATGCTGTAGCCCACATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274118    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002448.3-1340s21c1
Sequence:CCGGTTAGTACTCTTCTAGCATTTACTCGAGTAAATGCTAGAAGAGTACTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010835
VALIDATED
MSX1 MISSION shRNA Bacterial Glycerol Stock
msh homeobox 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000070625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010835.1-490s1c1
Sequence:CCGGCTCCTCAAGCTGCCAGAAGATCTCGAGATCTTCTGGCAGCTTGAGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010835.1-624s1c1
Sequence:CCGGCAAGCACAAGACCAACCGCAACTCGAGTTGCGGTTGGTCTTGTGCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010835.2-1144s21c1
Sequence:CCGGAGCATGTACCACCTGACTTAGCTCGAGCTAAGTCAGGTGGTACATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010835.1-990s1c1
Sequence:CCGGCCATGTAGGCTACAGCATGTACTCGAGTACATGCTGTAGCCTACATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010835.1-916s1c1
Sequence:CCGGGCCTCACTCTACAGTGCCTCTCTCGAGAGAGGCACTGTAGAGTGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010835.1-272s1c1
Sequence:CCGGCCAAGCCCAAAGTGCCCGCTTCTCGAGAAGCGGGCACTTTGGGCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348072    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010835.2-1397s21c1
Sequence:CCGGAGATTTACATGCGCAAGTTATCTCGAGATAACTTGCGCATGTAAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010835.2-830s21c1
Sequence:CCGGAGAAGCAGTACCTGTCTATTGCTCGAGCAATAGACAGGTACTGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010835.2-619s21c1
Sequence:CCGGCTCCTCAAGCTGCCAGAAGATCTCGAGATCTTCTGGCAGCTTGAGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010835.2-279s21c1
Sequence:CCGGTTTGCCACTCGGTGTCAAAGTCTCGAGACTTTGACACCGAGTGGCAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010835
VALIDATED
MSX1 MISSION shRNA shRNA Plasmid DNA
msh homeobox 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000070625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010835.1-490s1c1
Sequence:CCGGCTCCTCAAGCTGCCAGAAGATCTCGAGATCTTCTGGCAGCTTGAGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010835.1-624s1c1
Sequence:CCGGCAAGCACAAGACCAACCGCAACTCGAGTTGCGGTTGGTCTTGTGCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010835.2-1144s21c1
Sequence:CCGGAGCATGTACCACCTGACTTAGCTCGAGCTAAGTCAGGTGGTACATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010835.1-990s1c1
Sequence:CCGGCCATGTAGGCTACAGCATGTACTCGAGTACATGCTGTAGCCTACATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010835.1-916s1c1
Sequence:CCGGGCCTCACTCTACAGTGCCTCTCTCGAGAGAGGCACTGTAGAGTGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010835.1-272s1c1
Sequence:CCGGCCAAGCCCAAAGTGCCCGCTTCTCGAGAAGCGGGCACTTTGGGCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348072    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010835.2-1397s21c1
Sequence:CCGGAGATTTACATGCGCAAGTTATCTCGAGATAACTTGCGCATGTAAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010835.2-830s21c1
Sequence:CCGGAGAAGCAGTACCTGTCTATTGCTCGAGCAATAGACAGGTACTGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010835.2-619s21c1
Sequence:CCGGCTCCTCAAGCTGCCAGAAGATCTCGAGATCTTCTGGCAGCTTGAGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010835.2-279s21c1
Sequence:CCGGTTTGCCACTCGGTGTCAAAGTCTCGAGACTTTGACACCGAGTGGCAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010835
VALIDATED
MSX1 MISSION shRNA Lentiviral Transduction Particles
msh homeobox 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000070625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010835.1-490s1c1
Sequence:CCGGCTCCTCAAGCTGCCAGAAGATCTCGAGATCTTCTGGCAGCTTGAGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010835.1-624s1c1
Sequence:CCGGCAAGCACAAGACCAACCGCAACTCGAGTTGCGGTTGGTCTTGTGCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010835.2-1144s21c1
Sequence:CCGGAGCATGTACCACCTGACTTAGCTCGAGCTAAGTCAGGTGGTACATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010835.1-990s1c1
Sequence:CCGGCCATGTAGGCTACAGCATGTACTCGAGTACATGCTGTAGCCTACATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010835.1-916s1c1
Sequence:CCGGGCCTCACTCTACAGTGCCTCTCTCGAGAGAGGCACTGTAGAGTGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010835.1-272s1c1
Sequence:CCGGCCAAGCCCAAAGTGCCCGCTTCTCGAGAAGCGGGCACTTTGGGCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348072    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010835.2-1397s21c1
Sequence:CCGGAGATTTACATGCGCAAGTTATCTCGAGATAACTTGCGCATGTAAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010835.2-830s21c1
Sequence:CCGGAGAAGCAGTACCTGTCTATTGCTCGAGCAATAGACAGGTACTGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010835.2-619s21c1
Sequence:CCGGCTCCTCAAGCTGCCAGAAGATCTCGAGATCTTCTGGCAGCTTGAGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010835.2-279s21c1
Sequence:CCGGTTTGCCACTCGGTGTCAAAGTCTCGAGACTTTGACACCGAGTGGCAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)