EMAIL THIS PAGE TO A FRIEND

MSX2

msh homeobox 2

79 Gene Product Result for
Synonyms: CRS2 FPP HOX8 MSH PFM PFM1
UniProtKB ID: P35548, D3DQN1, Q53XM4, Q9UD60
Gene ID:
Human(4488) Summary: This gene encodes a member of the muscle segment homeobox gene family. The encoded protein is a transcriptional repressor whose normal activity may establish a balance between survival and apoptosis of neural crest-derived cells required for proper craniofacial morphogenesis. The encoded protein may also have a role in promoting cell growth under certain conditions and may be an important target for the RAS signaling pathways. Mutations in this gene are associated with parietal foramina 1 and craniosynostosis type 2. [provided by RefSeq, Jul 2008]
Mouse(17702) msh homeobox 2
Rat(25483) msh homeobox 2
Goat(100861257) msh homeobox 2
sheep(101107819) msh homeobox 2
naked mole-rat(101721042) msh homeobox 2
chicken(395245) msh homeobox 2
dog(403663) msh homeobox 2
cow(540230) msh homeobox 2
domestic cat(101089419) msh homeobox 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002449 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002449 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002449 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013601 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013601 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013601 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002449 Rosetta Predictions human pricing
NM_012982 Rosetta Predictions rat pricing
NM_013601 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002449 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00054025 predicted 629
2 SASI_Hs01_00054026 predicted 624
3 SASI_Hs01_00054027 predicted 911
4 SASI_Hs01_00054028 predicted 561
5 SASI_Hs01_00054030 predicted 905
6 SASI_Hs01_00054031 predicted 199
7 SASI_Hs01_00054032 predicted 443
8 SASI_Hs01_00054033 predicted 906
9 SASI_Hs02_00333851 predicted 439
10 SASI_Hs02_00333852 predicted 232
11 SASI_Hs01_00054029 predicted 497
12 SASI_Hs01_00054034 predicted 919
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012982 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00260596 predicted 777
2 SASI_Rn02_00260597 predicted 1175
3 SASI_Rn02_00260598 predicted 1297
4 SASI_Rn02_00260599 predicted 832
5 SASI_Rn02_00260600 predicted 1168
6 SASI_Rn02_00260601 predicted 1291
7 SASI_Rn01_00062956 predicted 568
8 SASI_Rn02_00260602 predicted 1033
9 SASI_Rn02_00260603 predicted 769
10 SASI_Rn02_00260604 predicted 1260
11 SASI_Rn01_00062957 predicted 96
12 SASI_Rn01_00062958 predicted 161
13 SASI_Rn01_00062959 predicted 152
14 SASI_Rn01_00062960 predicted 253
15 SASI_Rn01_00062961 predicted 25
16 SASI_Rn01_00062962 predicted 107
17 SASI_Rn01_00062963 predicted 322
18 SASI_Rn01_00062964 predicted 80
19 SASI_Rn01_00062965 predicted 371
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013601 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00152957 predicted 888
2 SASI_Mm02_00322345 predicted 847
3 SASI_Mm01_00152959 predicted 583
4 SASI_Mm02_00322346 predicted 963
5 SASI_Mm01_00152960 predicted 601
6 SASI_Mm01_00152961 predicted 769
7 SASI_Mm01_00152962 predicted 754
8 SASI_Mm01_00152963 predicted 702
9 SASI_Mm01_00152964 predicted 345
10 SASI_Mm02_00322347 predicted 842
11 SASI_Mm01_00152958 predicted 1153
12 SASI_Mm01_00152965 predicted 1142
13 SASI_Mm01_00152966 predicted 807
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002449
VALIDATED
MSX2 MISSION shRNA Bacterial Glycerol Stock
msh homeobox 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000020434    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002449.3-2001s1c1
Sequence:CCGGGCCCATTAAGTTCCCTGGTATCTCGAGATACCAGGGAACTTAATGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002449.3-543s1c1
Sequence:CCGGTCCGTCAGAAACAGTACCTCTCTCGAGAGAGGTACTGTTTCTGACGGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002449.3-759s1c1
Sequence:CCGGCGTCCATATATGGAGCATCCTCTCGAGAGGATGCTCCATATATGGACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_002449.3-782s1c1
Sequence:CCGGCCGTTCCATAGACCTGTGCTTCTCGAGAAGCACAGGTCTATGGAACGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002449.3-467s1c1
Sequence:CCGGCTGAGGAAACACAAGACCAATCTCGAGATTGGTCTTGTGTTTCCTCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234852    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002449.4-1333s21c1
Sequence:CCGGATGTGCTAAAGTCAATGATTTCTCGAGAAATCATTGACTTTAGCACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_002449.4-890s21c1
Sequence:CCGGTAAGGAAGACCAGATCAATAGCTCGAGCTATTGATCTGGTCTTCCTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002449.4-851s21c1
Sequence:CCGGTATGCCACGCCAGTGGGATATCTCGAGATATCCCACTGGCGTGGCATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_002449.4-777s21c1
Sequence:CCGGTGCAGGCAGCGTCCATATATGCTCGAGCATATATGGACGCTGCCTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_002449.4-561s21c1
Sequence:CCGGAGCGCAAGTTCCGTCAGAAACCTCGAGGTTTCTGACGGAACTTGCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002449
VALIDATED
MSX2 MISSION shRNA shRNA Plasmid DNA
msh homeobox 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000020434    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002449.3-2001s1c1
Sequence:CCGGGCCCATTAAGTTCCCTGGTATCTCGAGATACCAGGGAACTTAATGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002449.3-543s1c1
Sequence:CCGGTCCGTCAGAAACAGTACCTCTCTCGAGAGAGGTACTGTTTCTGACGGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002449.3-759s1c1
Sequence:CCGGCGTCCATATATGGAGCATCCTCTCGAGAGGATGCTCCATATATGGACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_002449.3-782s1c1
Sequence:CCGGCCGTTCCATAGACCTGTGCTTCTCGAGAAGCACAGGTCTATGGAACGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002449.3-467s1c1
Sequence:CCGGCTGAGGAAACACAAGACCAATCTCGAGATTGGTCTTGTGTTTCCTCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234852    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002449.4-1333s21c1
Sequence:CCGGATGTGCTAAAGTCAATGATTTCTCGAGAAATCATTGACTTTAGCACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_002449.4-890s21c1
Sequence:CCGGTAAGGAAGACCAGATCAATAGCTCGAGCTATTGATCTGGTCTTCCTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002449.4-851s21c1
Sequence:CCGGTATGCCACGCCAGTGGGATATCTCGAGATATCCCACTGGCGTGGCATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_002449.4-777s21c1
Sequence:CCGGTGCAGGCAGCGTCCATATATGCTCGAGCATATATGGACGCTGCCTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_002449.4-561s21c1
Sequence:CCGGAGCGCAAGTTCCGTCAGAAACCTCGAGGTTTCTGACGGAACTTGCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002449
VALIDATED
MSX2 MISSION shRNA Lentiviral Transduction Particles
msh homeobox 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000020434    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002449.3-2001s1c1
Sequence:CCGGGCCCATTAAGTTCCCTGGTATCTCGAGATACCAGGGAACTTAATGGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002449.3-543s1c1
Sequence:CCGGTCCGTCAGAAACAGTACCTCTCTCGAGAGAGGTACTGTTTCTGACGGATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002449.3-759s1c1
Sequence:CCGGCGTCCATATATGGAGCATCCTCTCGAGAGGATGCTCCATATATGGACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_002449.3-782s1c1
Sequence:CCGGCCGTTCCATAGACCTGTGCTTCTCGAGAAGCACAGGTCTATGGAACGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002449.3-467s1c1
Sequence:CCGGCTGAGGAAACACAAGACCAATCTCGAGATTGGTCTTGTGTTTCCTCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234852    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002449.4-1333s21c1
Sequence:CCGGATGTGCTAAAGTCAATGATTTCTCGAGAAATCATTGACTTTAGCACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_002449.4-890s21c1
Sequence:CCGGTAAGGAAGACCAGATCAATAGCTCGAGCTATTGATCTGGTCTTCCTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002449.4-851s21c1
Sequence:CCGGTATGCCACGCCAGTGGGATATCTCGAGATATCCCACTGGCGTGGCATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_002449.4-777s21c1
Sequence:CCGGTGCAGGCAGCGTCCATATATGCTCGAGCATATATGGACGCTGCCTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_002449.4-561s21c1
Sequence:CCGGAGCGCAAGTTCCGTCAGAAACCTCGAGGTTTCTGACGGAACTTGCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013601
MSX2 MISSION shRNA Bacterial Glycerol Stock
msh homeobox 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000070633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013601.1-771s1c1
Sequence:CCGGCCTGAGGAAACACAAGACCAACTCGAGTTGGTCTTGTGTTTCCTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013601.1-853s1c1
Sequence:CCGGCAGAAACAGTACCTGTCCATACTCGAGTATGGACAGGTACTGTTTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013601.1-1052s1c1
Sequence:CCGGCCCTGCAAGCAGCATCCATATCTCGAGATATGGATGCTGCTTGCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013601.1-1137s1c1
Sequence:CCGGGCCGGTTGGATATGGCATCTACTCGAGTAGATGCCATATCCAACCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013601.1-777s1c1
Sequence:CCGGGAAACACAAGACCAACCGGAACTCGAGTTCCGGTTGGTCTTGTGTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436146    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013601.2-1245s21c1
Sequence:CCGGGATATTGTGTTAAGTCCATTTCTCGAGAAATGGACTTAACACAATATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435115    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013601.2-1002s21c1
Sequence:CCGGCACTTGATACAGAGTGAATTTCTCGAGAAATTCACTCTGTATCAAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013601.2-532s21c1
Sequence:CCGGTCTAGCCTTGGAGCGCAAGTTCTCGAGAACTTGCGCTCCAAGGCTAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013601
MSX2 MISSION shRNA shRNA Plasmid DNA
msh homeobox 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000070633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013601.1-771s1c1
Sequence:CCGGCCTGAGGAAACACAAGACCAACTCGAGTTGGTCTTGTGTTTCCTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013601.1-853s1c1
Sequence:CCGGCAGAAACAGTACCTGTCCATACTCGAGTATGGACAGGTACTGTTTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013601.1-1052s1c1
Sequence:CCGGCCCTGCAAGCAGCATCCATATCTCGAGATATGGATGCTGCTTGCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013601.1-1137s1c1
Sequence:CCGGGCCGGTTGGATATGGCATCTACTCGAGTAGATGCCATATCCAACCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013601.1-777s1c1
Sequence:CCGGGAAACACAAGACCAACCGGAACTCGAGTTCCGGTTGGTCTTGTGTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436146    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013601.2-1245s21c1
Sequence:CCGGGATATTGTGTTAAGTCCATTTCTCGAGAAATGGACTTAACACAATATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435115    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013601.2-1002s21c1
Sequence:CCGGCACTTGATACAGAGTGAATTTCTCGAGAAATTCACTCTGTATCAAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013601.2-532s21c1
Sequence:CCGGTCTAGCCTTGGAGCGCAAGTTCTCGAGAACTTGCGCTCCAAGGCTAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013601
MSX2 MISSION shRNA Lentiviral Transduction Particles
msh homeobox 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000070633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013601.1-771s1c1
Sequence:CCGGCCTGAGGAAACACAAGACCAACTCGAGTTGGTCTTGTGTTTCCTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013601.1-853s1c1
Sequence:CCGGCAGAAACAGTACCTGTCCATACTCGAGTATGGACAGGTACTGTTTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013601.1-1052s1c1
Sequence:CCGGCCCTGCAAGCAGCATCCATATCTCGAGATATGGATGCTGCTTGCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013601.1-1137s1c1
Sequence:CCGGGCCGGTTGGATATGGCATCTACTCGAGTAGATGCCATATCCAACCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013601.1-777s1c1
Sequence:CCGGGAAACACAAGACCAACCGGAACTCGAGTTCCGGTTGGTCTTGTGTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436146    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013601.2-1245s21c1
Sequence:CCGGGATATTGTGTTAAGTCCATTTCTCGAGAAATGGACTTAACACAATATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435115    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013601.2-1002s21c1
Sequence:CCGGCACTTGATACAGAGTGAATTTCTCGAGAAATTCACTCTGTATCAAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013601.2-532s21c1
Sequence:CCGGTCTAGCCTTGGAGCGCAAGTTCTCGAGAACTTGCGCTCCAAGGCTAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)