EMAIL THIS PAGE TO A FRIEND

MT1A

metallothionein 1A

29 Gene Product Result for
Synonyms: MT1 MT1S MTC
UniProtKB ID: P04731, Q86YX5
Gene ID:
Rat(24567) metallothionein 1a
sheep(101117184) metallothionein 1A
Thale Cress(837273) metallothionein 1A
cow(404071) metallothionein-1A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1411900 ANTI-MT1A antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005946 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005946 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005946 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005946 Rosetta Predictions human pricing
NM_138826 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005946 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00030912 predicted 261
2 SASI_Hs01_00030913 predicted 263
3 SASI_Hs01_00030914 predicted 266
4 SASI_Hs01_00030915 predicted 264
5 SASI_Hs01_00030916 predicted 270
6 SASI_Hs01_00030917 predicted 262
7 SASI_Hs01_00030918 predicted 263
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138826 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00065310 predicted 312
2 SASI_Rn01_00065311 predicted 312
3 SASI_Rn02_00268200 predicted 265
4 SASI_Rn01_00065312 predicted 269
5 SASI_Rn01_00065313 predicted 263
6 SASI_Rn01_00065314 predicted 287
7 SASI_Rn02_00268201 predicted 241
8 SASI_Rn01_00065316 predicted 234
9 SASI_Rn01_00065317 predicted 263
10 SASI_Rn01_00065318 predicted 229
11 SASI_Rn01_00065315 predicted 239
12 SASI_Rn01_00065319 predicted 248
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005946
MT1A MISSION shRNA Bacterial Glycerol Stock
metallothionein 1A
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000445510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005946.2-231s21c1
Sequence:CCGGCATCAGAGAAGTGCAGCTGCTCTCGAGAGCAGCTGCACTTCTCTGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414755    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005946.2-297s21c1
Sequence:CCGCACCTGCACAAACTTGGAATTTCTCGAGAAATTCCAAGTTTGTGCAGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000440406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005946.2-148s21c1
Sequence:CCGGATGCACCTCCTGCAAGAAGAGCTCGAGCTCTTCTTGCAGGAGGTGCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421425    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005946.2-286s21c1
Sequence:CCGGTAGAAAGAGTGACCTGCACAACTCGAGTTGTGCAGGTCACTCTTTCTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005946.2-118s21c1
Sequence:CCGGCACTGGCTCCTGCAAATGCAACTCGAGTTGCATTTGCAGGAGCCAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163730    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005946.1-267s1c1
Sequence:CCGGGCCCTGCTCGAAGATATAGAACTCGAGTTCTATATCTTCGAGCAGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162420    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005946.1-142s1c1
Sequence:CCGGCAAATGCAACTCCTGCAAGAACTCGAGTTCTTGCAGGAGTTGCATTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162839    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005946.1-121s1c1
Sequence:CCGGCTCCTGCAAATGCAAAGAGTGCTCGAGCACTCTTTGCATTTGCAGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163015    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005946.1-139s1c1
Sequence:CCGGGTGCAAATGCAACTCCTGCAACTCGAGTTGCAGGAGTTGCATTTGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163144    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005946.1-141s1c1
Sequence:CCGGGCAAATGCAACTCCTGCAAGACTCGAGTCTTGCAGGAGTTGCATTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161498    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005946.1-132s1c1
Sequence:CCGGGCAAAGAGTGCAAATGCAACTCTCGAGAGTTGCATTTGCACTCTTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158788    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005946.1-272s1c1
Sequence:CCGGGCTCGAAGATATAGAAAGAGTCTCGAGACTCTTTCTATATCTTCGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159156    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005946.1-126s1c1
Sequence:CCGGGCAAATGCAAAGAGTGCAAATCTCGAGATTTGCACTCTTTGCATTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005946
MT1A MISSION shRNA shRNA Plasmid DNA
metallothionein 1A
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000445510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005946.2-231s21c1
Sequence:CCGGCATCAGAGAAGTGCAGCTGCTCTCGAGAGCAGCTGCACTTCTCTGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414755    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005946.2-297s21c1
Sequence:CCGCACCTGCACAAACTTGGAATTTCTCGAGAAATTCCAAGTTTGTGCAGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000440406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005946.2-148s21c1
Sequence:CCGGATGCACCTCCTGCAAGAAGAGCTCGAGCTCTTCTTGCAGGAGGTGCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421425    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005946.2-286s21c1
Sequence:CCGGTAGAAAGAGTGACCTGCACAACTCGAGTTGTGCAGGTCACTCTTTCTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005946.2-118s21c1
Sequence:CCGGCACTGGCTCCTGCAAATGCAACTCGAGTTGCATTTGCAGGAGCCAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163730    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005946.1-267s1c1
Sequence:CCGGGCCCTGCTCGAAGATATAGAACTCGAGTTCTATATCTTCGAGCAGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162420    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005946.1-142s1c1
Sequence:CCGGCAAATGCAACTCCTGCAAGAACTCGAGTTCTTGCAGGAGTTGCATTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162839    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005946.1-121s1c1
Sequence:CCGGCTCCTGCAAATGCAAAGAGTGCTCGAGCACTCTTTGCATTTGCAGGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163015    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005946.1-139s1c1
Sequence:CCGGGTGCAAATGCAACTCCTGCAACTCGAGTTGCAGGAGTTGCATTTGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163144    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005946.1-141s1c1
Sequence:CCGGGCAAATGCAACTCCTGCAAGACTCGAGTCTTGCAGGAGTTGCATTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161498    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005946.1-132s1c1
Sequence:CCGGGCAAAGAGTGCAAATGCAACTCTCGAGAGTTGCATTTGCACTCTTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158788    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005946.1-272s1c1
Sequence:CCGGGCTCGAAGATATAGAAAGAGTCTCGAGACTCTTTCTATATCTTCGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159156    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005946.1-126s1c1
Sequence:CCGGGCAAATGCAAAGAGTGCAAATCTCGAGATTTGCACTCTTTGCATTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005946
MT1A MISSION shRNA Lentiviral Transduction Particles
metallothionein 1A
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000445510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005946.2-231s21c1
Sequence:CCGGCATCAGAGAAGTGCAGCTGCTCTCGAGAGCAGCTGCACTTCTCTGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414755    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005946.2-297s21c1
Sequence:CCGCACCTGCACAAACTTGGAATTTCTCGAGAAATTCCAAGTTTGTGCAGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000440406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005946.2-148s21c1
Sequence:CCGGATGCACCTCCTGCAAGAAGAGCTCGAGCTCTTCTTGCAGGAGGTGCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421425    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005946.2-286s21c1
Sequence:CCGGTAGAAAGAGTGACCTGCACAACTCGAGTTGTGCAGGTCACTCTTTCTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005946.2-118s21c1
Sequence:CCGGCACTGGCTCCTGCAAATGCAACTCGAGTTGCATTTGCAGGAGCCAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163730    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005946.1-267s1c1
Sequence:CCGGGCCCTGCTCGAAGATATAGAACTCGAGTTCTATATCTTCGAGCAGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162420    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005946.1-142s1c1
Sequence:CCGGCAAATGCAACTCCTGCAAGAACTCGAGTTCTTGCAGGAGTTGCATTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162839    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005946.1-121s1c1
Sequence:CCGGCTCCTGCAAATGCAAAGAGTGCTCGAGCACTCTTTGCATTTGCAGGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163015    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005946.1-139s1c1
Sequence:CCGGGTGCAAATGCAACTCCTGCAACTCGAGTTGCAGGAGTTGCATTTGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163144    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005946.1-141s1c1
Sequence:CCGGGCAAATGCAACTCCTGCAAGACTCGAGTCTTGCAGGAGTTGCATTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161498    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005946.1-132s1c1
Sequence:CCGGGCAAAGAGTGCAAATGCAACTCTCGAGAGTTGCATTTGCACTCTTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158788    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005946.1-272s1c1
Sequence:CCGGGCTCGAAGATATAGAAAGAGTCTCGAGACTCTTTCTATATCTTCGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159156    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005946.1-126s1c1
Sequence:CCGGGCAAATGCAAAGAGTGCAAATCTCGAGATTTGCACTCTTTGCATTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)