EMAIL THIS PAGE TO A FRIEND

MT1B

metallothionein 1B

10 Gene Product Result for
Synonyms: MT1 MT1Q MTP
Species: Human MT1B(4490), Thale Cress MT1B(3771524)
UniProtKB ID: P07438
Gene ID:
Thale Cress(3771524) metallothionein 1B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005947 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005947 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005947 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU149531 MISSION® esiRNA esiRNA human MT1B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005947 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005947 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00162260 predicted 258
2 SASI_Hs01_00162261 predicted 308
3 SASI_Hs01_00162262 predicted 188
4 SASI_Hs01_00162263 predicted 196
5 SASI_Hs01_00162264 predicted 189
6 SASI_Hs01_00162265 predicted 246
7 SASI_Hs02_00340612 predicted 336
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005947
MT1B MISSION shRNA Bacterial Glycerol Stock
metallothionein 1B
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000219901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005947.2-103s1c1
Sequence:CCGGCGGCTCCTGCAAGTGCAAAGACTCGAGTCTTTGCACTTGCAGGAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005947.1-116s1c1
Sequence:CCGGGTGCAAAGAGTGCAAATGTACCTCGAGGTACATTTGCACTCTTTGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005947.1-127s1c1
Sequence:CCGGGCAAATGTACCTCCTGCAAGACTCGAGTCTTGCAGGAGGTACATTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005947.1-125s1c1
Sequence:CCGGGTGCAAATGTACCTCCTGCAACTCGAGTTGCAGGAGGTACATTTGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005947.2-141s1c1
Sequence:CCGGGCAAGAAGTGCTGCTGCTCTTCTCGAGAAGAGCAGCAGCACTTCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005947.2-231s1c1
Sequence:CCGGGCTGTGCCTGATGTTGGGAGACTCGAGTCTCCCAACATCAGGCACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005947.1-203s1c1
Sequence:CCGGCTGCAAAGGCTCATCAGAGAACTCGAGTTCTCTGATGAGCCTTTGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005947.1-205s1c1
Sequence:CCGGGCAAAGGCTCATCAGAGAAGTCTCGAGACTTCTCTGATGAGCCTTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005947.1-118s1c1
Sequence:CCGGGCAAAGAGTGCAAATGTACCTCTCGAGAGGTACATTTGCACTCTTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005947
MT1B MISSION shRNA shRNA Plasmid DNA
metallothionein 1B
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000219901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005947.2-103s1c1
Sequence:CCGGCGGCTCCTGCAAGTGCAAAGACTCGAGTCTTTGCACTTGCAGGAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005947.1-116s1c1
Sequence:CCGGGTGCAAAGAGTGCAAATGTACCTCGAGGTACATTTGCACTCTTTGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005947.1-127s1c1
Sequence:CCGGGCAAATGTACCTCCTGCAAGACTCGAGTCTTGCAGGAGGTACATTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005947.1-125s1c1
Sequence:CCGGGTGCAAATGTACCTCCTGCAACTCGAGTTGCAGGAGGTACATTTGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005947.2-141s1c1
Sequence:CCGGGCAAGAAGTGCTGCTGCTCTTCTCGAGAAGAGCAGCAGCACTTCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005947.2-231s1c1
Sequence:CCGGGCTGTGCCTGATGTTGGGAGACTCGAGTCTCCCAACATCAGGCACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005947.1-203s1c1
Sequence:CCGGCTGCAAAGGCTCATCAGAGAACTCGAGTTCTCTGATGAGCCTTTGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005947.1-205s1c1
Sequence:CCGGGCAAAGGCTCATCAGAGAAGTCTCGAGACTTCTCTGATGAGCCTTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005947.1-118s1c1
Sequence:CCGGGCAAAGAGTGCAAATGTACCTCTCGAGAGGTACATTTGCACTCTTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005947
MT1B MISSION shRNA Lentiviral Transduction Particles
metallothionein 1B
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000219901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005947.2-103s1c1
Sequence:CCGGCGGCTCCTGCAAGTGCAAAGACTCGAGTCTTTGCACTTGCAGGAGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005947.1-116s1c1
Sequence:CCGGGTGCAAAGAGTGCAAATGTACCTCGAGGTACATTTGCACTCTTTGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005947.1-127s1c1
Sequence:CCGGGCAAATGTACCTCCTGCAAGACTCGAGTCTTGCAGGAGGTACATTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005947.1-125s1c1
Sequence:CCGGGTGCAAATGTACCTCCTGCAACTCGAGTTGCAGGAGGTACATTTGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005947.2-141s1c1
Sequence:CCGGGCAAGAAGTGCTGCTGCTCTTCTCGAGAAGAGCAGCAGCACTTCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005947.2-231s1c1
Sequence:CCGGGCTGTGCCTGATGTTGGGAGACTCGAGTCTCCCAACATCAGGCACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005947.1-203s1c1
Sequence:CCGGCTGCAAAGGCTCATCAGAGAACTCGAGTTCTCTGATGAGCCTTTGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005947.1-205s1c1
Sequence:CCGGGCAAAGGCTCATCAGAGAAGTCTCGAGACTTCTCTGATGAGCCTTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005947.1-118s1c1
Sequence:CCGGGCAAAGAGTGCAAATGTACCTCTCGAGAGGTACATTTGCACTCTTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)