EMAIL THIS PAGE TO A FRIEND

MT1E

metallothionein 1E

22 Gene Product Result for
Synonyms: MT1 MTD
UniProtKB ID: P04732, A2RRF7, Q86YX4, Q8TD51
Gene ID:
dog(403800) metallothionein 1E
domestic cat(101081428) metallothionein 1E
cow(768319) metallothionein 1E
cow(613358) metallothionein 1E
sheep(101117441) metallothionein 1E
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175617 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_175617 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_175617 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU122591 MISSION® esiRNA esiRNA human MT1E (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_175617 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175617 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00131564 predicted 191
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175617
VALIDATED
MT1E MISSION shRNA Bacterial Glycerol Stock
metallothionein 1E
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000157715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175617.2-344s1c1
Sequence:CCGGCCCTATGGTTTCAGAACAGAGCTCGAGCTCTGTTCTGAAACCATAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156425    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175617.2-345s1c1
Sequence:CCGGCCTATGGTTTCAGAACAGAGCCTCGAGGCTCTGTTCTGAAACCATAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175617.2-276s1c1
Sequence:CCGGCTTTCTGCCCTAAATTCAGATCTCGAGATCTGAATTTAGGGCAGAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153181    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175617.2-275s1c1
Sequence:CCGGGCTTTCTGCCCTAAATTCAGACTCGAGTCTGAATTTAGGGCAGAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_175617.2-102s1c1
Sequence:CCGGGCAAGTGCAAAGAGTGCAAATCTCGAGATTTGCACTCTTTGCACTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175617.2-346s1c1
Sequence:CCGGCTATGGTTTCAGAACAGAGCTCTCGAGAGCTCTGTTCTGAAACCATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_175617.2-100s1c1
Sequence:CCGGCTGCAAGTGCAAAGAGTGCAACTCGAGTTGCACTCTTTGCACTTGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175617.3-337s21c1
Sequence:CCGGCATCGGAGAAGTGCAGCTGCTCTCGAGAGCAGCTGCACTTCTCCGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175617.3-249s21c1
Sequence:CCGGTGCAAATGCACCTCCTGCAAGCTCGAGCTTGCAGGAGGTGCATTTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175617.3-262s21c1
Sequence:CCGGCCTGCAAGAAGAGCTGCTGTTCTCGAGAACAGCAGCTCTTCTTGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175617.3-348s21c1
Sequence:CCGGTGCAGCTGCTGTGCCTGATGTCTCGAGACATCAGGCACAGCAGCTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175617
VALIDATED
MT1E MISSION shRNA shRNA Plasmid DNA
metallothionein 1E
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000157715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175617.2-344s1c1
Sequence:CCGGCCCTATGGTTTCAGAACAGAGCTCGAGCTCTGTTCTGAAACCATAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156425    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175617.2-345s1c1
Sequence:CCGGCCTATGGTTTCAGAACAGAGCCTCGAGGCTCTGTTCTGAAACCATAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175617.2-276s1c1
Sequence:CCGGCTTTCTGCCCTAAATTCAGATCTCGAGATCTGAATTTAGGGCAGAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153181    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175617.2-275s1c1
Sequence:CCGGGCTTTCTGCCCTAAATTCAGACTCGAGTCTGAATTTAGGGCAGAAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_175617.2-102s1c1
Sequence:CCGGGCAAGTGCAAAGAGTGCAAATCTCGAGATTTGCACTCTTTGCACTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175617.2-346s1c1
Sequence:CCGGCTATGGTTTCAGAACAGAGCTCTCGAGAGCTCTGTTCTGAAACCATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_175617.2-100s1c1
Sequence:CCGGCTGCAAGTGCAAAGAGTGCAACTCGAGTTGCACTCTTTGCACTTGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175617.3-337s21c1
Sequence:CCGGCATCGGAGAAGTGCAGCTGCTCTCGAGAGCAGCTGCACTTCTCCGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175617.3-249s21c1
Sequence:CCGGTGCAAATGCACCTCCTGCAAGCTCGAGCTTGCAGGAGGTGCATTTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175617.3-262s21c1
Sequence:CCGGCCTGCAAGAAGAGCTGCTGTTCTCGAGAACAGCAGCTCTTCTTGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175617.3-348s21c1
Sequence:CCGGTGCAGCTGCTGTGCCTGATGTCTCGAGACATCAGGCACAGCAGCTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175617
VALIDATED
MT1E MISSION shRNA Lentiviral Transduction Particles
metallothionein 1E
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000157715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175617.2-344s1c1
Sequence:CCGGCCCTATGGTTTCAGAACAGAGCTCGAGCTCTGTTCTGAAACCATAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156425    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175617.2-345s1c1
Sequence:CCGGCCTATGGTTTCAGAACAGAGCCTCGAGGCTCTGTTCTGAAACCATAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175617.2-276s1c1
Sequence:CCGGCTTTCTGCCCTAAATTCAGATCTCGAGATCTGAATTTAGGGCAGAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153181    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175617.2-275s1c1
Sequence:CCGGGCTTTCTGCCCTAAATTCAGACTCGAGTCTGAATTTAGGGCAGAAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_175617.2-102s1c1
Sequence:CCGGGCAAGTGCAAAGAGTGCAAATCTCGAGATTTGCACTCTTTGCACTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175617.2-346s1c1
Sequence:CCGGCTATGGTTTCAGAACAGAGCTCTCGAGAGCTCTGTTCTGAAACCATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_175617.2-100s1c1
Sequence:CCGGCTGCAAGTGCAAAGAGTGCAACTCGAGTTGCACTCTTTGCACTTGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175617.3-337s21c1
Sequence:CCGGCATCGGAGAAGTGCAGCTGCTCTCGAGAGCAGCTGCACTTCTCCGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175617.3-249s21c1
Sequence:CCGGTGCAAATGCACCTCCTGCAAGCTCGAGCTTGCAGGAGGTGCATTTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175617.3-262s21c1
Sequence:CCGGCCTGCAAGAAGAGCTGCTGTTCTCGAGAACAGCAGCTCTTCTTGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175617.3-348s21c1
Sequence:CCGGTGCAGCTGCTGTGCCTGATGTCTCGAGACATCAGGCACAGCAGCTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)