EMAIL THIS PAGE TO A FRIEND

MT1F

metallothionein 1F

23 Gene Product Result for
Synonyms: MT1
Species: Human MT1F(4494)
UniProtKB ID: P04733, Q9UI97
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005949 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005949 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005949 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU117211 MISSION® esiRNA esiRNA human MT1F (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005949 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005949 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00175276 predicted 312
2 SASI_Hs01_00175278 predicted 317
3 SASI_Hs01_00175279 predicted 301
4 SASI_Hs01_00175280 predicted 159
5 SASI_Hs01_00175281 predicted 159
6 SASI_Hs01_00175282 predicted 305
7 SASI_Hs01_00175283 predicted 292
8 SASI_Hs01_00175284 predicted 287
9 SASI_Hs01_00175285 predicted 301
10 SASI_Hs02_00340613 predicted 397
11 SASI_Hs01_00175277 predicted 406
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005949
MT1F MISSION shRNA Bacterial Glycerol Stock
metallothionein 1F
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000072608    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005949.1-310s1c1
Sequence:CCGGACAACCTTTCTCCCAGATGTACTCGAGTACATCTGGGAGAAAGGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005949.1-238s1c1
Sequence:CCGGGTAGCAAGTGTGCCCAGGGCTCTCGAGAGCCCTGGGCACACTTGCTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005949.1-161s1c1
Sequence:CCGGCGCTGGTTCCTGCAAGTGCAACTCGAGTTGCACTTGCAGGAACCAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005949.1-188s1c1
Sequence:CCGGCAAATGCACCTCCTGCAAGAACTCGAGTTCTTGCAGGAGGTGCATTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005949.1-172s1c1
Sequence:CCGGGCAAGTGCAAAGAGTGCAAATCTCGAGATTTGCACTCTTTGCACTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005949
MT1F MISSION shRNA shRNA Plasmid DNA
metallothionein 1F
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000072608    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005949.1-310s1c1
Sequence:CCGGACAACCTTTCTCCCAGATGTACTCGAGTACATCTGGGAGAAAGGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005949.1-238s1c1
Sequence:CCGGGTAGCAAGTGTGCCCAGGGCTCTCGAGAGCCCTGGGCACACTTGCTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005949.1-161s1c1
Sequence:CCGGCGCTGGTTCCTGCAAGTGCAACTCGAGTTGCACTTGCAGGAACCAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005949.1-188s1c1
Sequence:CCGGCAAATGCACCTCCTGCAAGAACTCGAGTTCTTGCAGGAGGTGCATTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005949.1-172s1c1
Sequence:CCGGGCAAGTGCAAAGAGTGCAAATCTCGAGATTTGCACTCTTTGCACTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005949
MT1F MISSION shRNA Lentiviral Transduction Particles
metallothionein 1F
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000072608    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005949.1-310s1c1
Sequence:CCGGACAACCTTTCTCCCAGATGTACTCGAGTACATCTGGGAGAAAGGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005949.1-238s1c1
Sequence:CCGGGTAGCAAGTGTGCCCAGGGCTCTCGAGAGCCCTGGGCACACTTGCTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005949.1-161s1c1
Sequence:CCGGCGCTGGTTCCTGCAAGTGCAACTCGAGTTGCACTTGCAGGAACCAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005949.1-188s1c1
Sequence:CCGGCAAATGCACCTCCTGCAAGAACTCGAGTTCTTGCAGGAGGTGCATTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005949.1-172s1c1
Sequence:CCGGGCAAGTGCAAAGAGTGCAAATCTCGAGATTTGCACTCTTTGCACTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)