EMAIL THIS PAGE TO A FRIEND

MT1G

metallothionein 1G

18 Gene Product Result for
Synonyms: MT1 MT1K
Species: Human MT1G(4495)
UniProtKB ID: P13640, P80296
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005950 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005950 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005950 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005950 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005950 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00149694 predicted 264
2 SASI_Hs01_00149695 predicted 268
3 SASI_Hs01_00149696 predicted 261
4 SASI_Hs01_00149697 predicted 267
5 SASI_Hs01_00149698 predicted 272
6 SASI_Hs01_00149699 predicted 263
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005950
VALIDATED
MT1G MISSION shRNA Bacterial Glycerol Stock
metallothionein 1G
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000242864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005950.1-87s21c1
Sequence:CCGGCTCCTGTGCCGCTGGTGTCTCCTCGAGGAGACACCAGCGGCACAGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005950.1-155s21c1
Sequence:CCGGCCTGCAAGAAGAGCTGCTGCTCTCGAGAGCAGCAGCTCTTCTTGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005950.1-118s21c1
Sequence:CCGGGCCAGCTCCTGCAAGTGCAAACTCGAGTTTGCACTTGCAGGAGCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005950.1-206s21c1
Sequence:CCGGCCCAAGGCTGCATCTGCAAAGCTCGAGCTTTGCAGATGCAGCCTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005950.1-129s21c1
Sequence:CCGGCAAGTGCAAAGAGTGCAAATGCTCGAGCATTTGCACTCTTTGCACTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005950
VALIDATED
MT1G MISSION shRNA shRNA Plasmid DNA
metallothionein 1G
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000242864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005950.1-87s21c1
Sequence:CCGGCTCCTGTGCCGCTGGTGTCTCCTCGAGGAGACACCAGCGGCACAGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005950.1-155s21c1
Sequence:CCGGCCTGCAAGAAGAGCTGCTGCTCTCGAGAGCAGCAGCTCTTCTTGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005950.1-118s21c1
Sequence:CCGGGCCAGCTCCTGCAAGTGCAAACTCGAGTTTGCACTTGCAGGAGCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005950.1-206s21c1
Sequence:CCGGCCCAAGGCTGCATCTGCAAAGCTCGAGCTTTGCAGATGCAGCCTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005950.1-129s21c1
Sequence:CCGGCAAGTGCAAAGAGTGCAAATGCTCGAGCATTTGCACTCTTTGCACTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005950
VALIDATED
MT1G MISSION shRNA Lentiviral Transduction Particles
metallothionein 1G
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000242864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005950.1-87s21c1
Sequence:CCGGCTCCTGTGCCGCTGGTGTCTCCTCGAGGAGACACCAGCGGCACAGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005950.1-155s21c1
Sequence:CCGGCCTGCAAGAAGAGCTGCTGCTCTCGAGAGCAGCAGCTCTTCTTGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005950.1-118s21c1
Sequence:CCGGGCCAGCTCCTGCAAGTGCAAACTCGAGTTTGCACTTGCAGGAGCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005950.1-206s21c1
Sequence:CCGGCCCAAGGCTGCATCTGCAAAGCTCGAGCTTTGCAGATGCAGCCTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005950.1-129s21c1
Sequence:CCGGCAAGTGCAAAGAGTGCAAATGCTCGAGCATTTGCACTCTTTGCACTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)