EMAIL THIS PAGE TO A FRIEND

MT1H

metallothionein 1H

13 Gene Product Result for
Synonyms: MT-0 MT-1H MT-IH MT1
Species: Human MT1H(4496)
UniProtKB ID: P80294, B2RUY6
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005951 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005951 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005951 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005951 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005951 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00060899 predicted 264
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005951
MT1H MISSION shRNA Bacterial Glycerol Stock
metallothionein 1H
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000257215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005951.2-117s21c1
Sequence:CCGGGCCGGCTCCTGCAAGTGCAAACTCGAGTTTGCACTTGCAGGAGCCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005951.2-142s21c1
Sequence:CCGGGCAAATGCACCTCCTGCAAGACTCGAGTCTTGCAGGAGGTGCATTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005951.2-205s21c1
Sequence:CCGGCCCAGGGCTGCATCTGCAAAGCTCGAGCTTTGCAGATGCAGCCCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005951.2-160s21c1
Sequence:CCGGAGAAGAGCTGCTGCTCCTGTTCTCGAGAACAGGAGCAGCAGCTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005951
MT1H MISSION shRNA shRNA Plasmid DNA
metallothionein 1H
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000257215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005951.2-117s21c1
Sequence:CCGGGCCGGCTCCTGCAAGTGCAAACTCGAGTTTGCACTTGCAGGAGCCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005951.2-142s21c1
Sequence:CCGGGCAAATGCACCTCCTGCAAGACTCGAGTCTTGCAGGAGGTGCATTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005951.2-205s21c1
Sequence:CCGGCCCAGGGCTGCATCTGCAAAGCTCGAGCTTTGCAGATGCAGCCCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005951.2-160s21c1
Sequence:CCGGAGAAGAGCTGCTGCTCCTGTTCTCGAGAACAGGAGCAGCAGCTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005951
MT1H MISSION shRNA Lentiviral Transduction Particles
metallothionein 1H
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000257215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005951.2-117s21c1
Sequence:CCGGGCCGGCTCCTGCAAGTGCAAACTCGAGTTTGCACTTGCAGGAGCCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005951.2-142s21c1
Sequence:CCGGGCAAATGCACCTCCTGCAAGACTCGAGTCTTGCAGGAGGTGCATTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005951.2-205s21c1
Sequence:CCGGCCCAGGGCTGCATCTGCAAAGCTCGAGCTTTGCAGATGCAGCCCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005951.2-160s21c1
Sequence:CCGGAGAAGAGCTGCTGCTCCTGTTCTCGAGAACAGGAGCAGCAGCTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)