EMAIL THIS PAGE TO A FRIEND

MT1M

metallothionein 1M

6 Gene Product Result for
Synonyms: MT-1M MT-IM MT1 MT1K
UniProtKB ID: Q8N339, Q8TDN3
Gene ID:
Human(4499) Summary: This gene encodes a member of the metallothionein superfamily, type 1 family. Metallothioneins have a high content of cysteine residues that bind various heavy metals. These genes are transcriptionally regulated by both heavy metals and glucocorticoids. [provided by RefSeq, Oct 2011]
Rat(100362623) metallothionein 1M
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_176870 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_176870 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_176870 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_176870
VALIDATED
MT1M MISSION shRNA Bacterial Glycerol Stock
metallothionein 1M
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000243005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176870.2-156s21c1
Sequence:CCGGACCGGCTCCTGCAAGTGCAAACTCGAGTTTGCACTTGCAGGAGCCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_176870.2-270s21c1
Sequence:CCGGTTGGAGAACTGCAGCTGCTGTCTCGAGACAGCAGCTGCAGTTCTCCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_176870.2-294s21c1
Sequence:CCGGTGATGTGGGAACAGCTCTTCTCTCGAGAGAAGAGCTGTTCCCACATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243006    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_176870.2-305s21c1
Sequence:CCGGCAGCTCTTCTCCCAGATGTTACTCGAGTAACATCTGGGAGAAGAGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_176870.2-252s21c1
Sequence:CCGGTGTGTCTGCAAAGGGACGTTGCTCGAGCAACGTCCCTTTGCAGACACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180331    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_176870.1-267s1c1
Sequence:CCGGCAGCTCTTCTCCCAGATGTTACTCGAGTAACATCTGGGAGAAGAGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_176870
VALIDATED
MT1M MISSION shRNA shRNA Plasmid DNA
metallothionein 1M
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000243005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176870.2-156s21c1
Sequence:CCGGACCGGCTCCTGCAAGTGCAAACTCGAGTTTGCACTTGCAGGAGCCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_176870.2-270s21c1
Sequence:CCGGTTGGAGAACTGCAGCTGCTGTCTCGAGACAGCAGCTGCAGTTCTCCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_176870.2-294s21c1
Sequence:CCGGTGATGTGGGAACAGCTCTTCTCTCGAGAGAAGAGCTGTTCCCACATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243006    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_176870.2-305s21c1
Sequence:CCGGCAGCTCTTCTCCCAGATGTTACTCGAGTAACATCTGGGAGAAGAGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_176870.2-252s21c1
Sequence:CCGGTGTGTCTGCAAAGGGACGTTGCTCGAGCAACGTCCCTTTGCAGACACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180331    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_176870.1-267s1c1
Sequence:CCGGCAGCTCTTCTCCCAGATGTTACTCGAGTAACATCTGGGAGAAGAGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_176870
VALIDATED
MT1M MISSION shRNA Lentiviral Transduction Particles
metallothionein 1M
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000243005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176870.2-156s21c1
Sequence:CCGGACCGGCTCCTGCAAGTGCAAACTCGAGTTTGCACTTGCAGGAGCCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_176870.2-270s21c1
Sequence:CCGGTTGGAGAACTGCAGCTGCTGTCTCGAGACAGCAGCTGCAGTTCTCCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_176870.2-294s21c1
Sequence:CCGGTGATGTGGGAACAGCTCTTCTCTCGAGAGAAGAGCTGTTCCCACATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243006    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_176870.2-305s21c1
Sequence:CCGGCAGCTCTTCTCCCAGATGTTACTCGAGTAACATCTGGGAGAAGAGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_176870.2-252s21c1
Sequence:CCGGTGTGTCTGCAAAGGGACGTTGCTCGAGCAACGTCCCTTTGCAGACACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180331    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_176870.1-267s1c1
Sequence:CCGGCAGCTCTTCTCCCAGATGTTACTCGAGTAACATCTGGGAGAAGAGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)