EMAIL THIS PAGE TO A FRIEND

MT1X

metallothionein 1X

22 Gene Product Result for
Synonyms: MT-1l MT1
Species: Human MT1X(4501)
UniProtKB ID: P80297, A8MUC7
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005952 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005952 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005952 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005952 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005952 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00204061 predicted 322
2 SASI_Hs01_00204066 predicted 81
3 SASI_Hs01_00204065 predicted 235
4 SASI_Hs02_00340614 predicted 247
5 SASI_Hs02_00340615 predicted 346
6 SASI_Hs01_00204062 predicted 244
7 SASI_Hs01_00204063 predicted 269
8 SASI_Hs01_00204067 predicted 240
9 SASI_Hs01_00204064 predicted 246
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005952
VALIDATED
MT1X MISSION shRNA Bacterial Glycerol Stock
metallothionein 1X
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000179491    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_005952.2-255s1c1
Sequence:CCGGGCTGTGCTCTCAGATGTAAATCTCGAGATTTACATCTGAGAGCACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_005952.2-120s1c1
Sequence:CCGGGCAAAGAGTGCAAATGCACCTCTCGAGAGGTGCATTTGCACTCTTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005952.2-114s1c1
Sequence:CCGGGCAAATGCAAAGAGTGCAAATCTCGAGATTTGCACTCTTTGCATTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151409    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005952.2-279s1c1
Sequence:CCGGGCAACCTATATAAACCTGGATCTCGAGATCCAGGTTTATATAGGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_005952.2-130s1c1
Sequence:CCGGCAAATGCACCTCCTGCAAGAACTCGAGTTCTTGCAGGAGGTGCATTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005952.3-218s21c1
Sequence:CCGGCTGCAAAGGGACGTCAGACAACTCGAGTTGTCTGACGTCCCTTTGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005952.3-255s21c1
Sequence:CCGGTGATGCCAGGACAGCTGTGCTCTCGAGAGCACAGCTGTCCTGGCATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005952.3-116s21c1
Sequence:CCGGTGCCGGCTCCTGCAAATGCAACTCGAGTTGCATTTGCAGGAGCCGGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005952.3-238s21c1
Sequence:CCGGAGTGCAGCTGCTGTGCCTGATCTCGAGATCAGGCACAGCAGCTGCACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005952
VALIDATED
MT1X MISSION shRNA shRNA Plasmid DNA
metallothionein 1X
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000179491    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_005952.2-255s1c1
Sequence:CCGGGCTGTGCTCTCAGATGTAAATCTCGAGATTTACATCTGAGAGCACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_005952.2-120s1c1
Sequence:CCGGGCAAAGAGTGCAAATGCACCTCTCGAGAGGTGCATTTGCACTCTTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005952.2-114s1c1
Sequence:CCGGGCAAATGCAAAGAGTGCAAATCTCGAGATTTGCACTCTTTGCATTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151409    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005952.2-279s1c1
Sequence:CCGGGCAACCTATATAAACCTGGATCTCGAGATCCAGGTTTATATAGGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_005952.2-130s1c1
Sequence:CCGGCAAATGCACCTCCTGCAAGAACTCGAGTTCTTGCAGGAGGTGCATTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005952.3-218s21c1
Sequence:CCGGCTGCAAAGGGACGTCAGACAACTCGAGTTGTCTGACGTCCCTTTGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005952.3-255s21c1
Sequence:CCGGTGATGCCAGGACAGCTGTGCTCTCGAGAGCACAGCTGTCCTGGCATCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005952.3-116s21c1
Sequence:CCGGTGCCGGCTCCTGCAAATGCAACTCGAGTTGCATTTGCAGGAGCCGGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005952.3-238s21c1
Sequence:CCGGAGTGCAGCTGCTGTGCCTGATCTCGAGATCAGGCACAGCAGCTGCACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005952
VALIDATED
MT1X MISSION shRNA Lentiviral Transduction Particles
metallothionein 1X
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000179491    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_005952.2-255s1c1
Sequence:CCGGGCTGTGCTCTCAGATGTAAATCTCGAGATTTACATCTGAGAGCACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_005952.2-120s1c1
Sequence:CCGGGCAAAGAGTGCAAATGCACCTCTCGAGAGGTGCATTTGCACTCTTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005952.2-114s1c1
Sequence:CCGGGCAAATGCAAAGAGTGCAAATCTCGAGATTTGCACTCTTTGCATTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151409    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005952.2-279s1c1
Sequence:CCGGGCAACCTATATAAACCTGGATCTCGAGATCCAGGTTTATATAGGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_005952.2-130s1c1
Sequence:CCGGCAAATGCACCTCCTGCAAGAACTCGAGTTCTTGCAGGAGGTGCATTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005952.3-218s21c1
Sequence:CCGGCTGCAAAGGGACGTCAGACAACTCGAGTTGTCTGACGTCCCTTTGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005952.3-255s21c1
Sequence:CCGGTGATGCCAGGACAGCTGTGCTCTCGAGAGCACAGCTGTCCTGGCATCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005952.3-116s21c1
Sequence:CCGGTGCCGGCTCCTGCAAATGCAACTCGAGTTGCATTTGCAGGAGCCGGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005952.3-238s21c1
Sequence:CCGGAGTGCAGCTGCTGTGCCTGATCTCGAGATCAGGCACAGCAGCTGCACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)