EMAIL THIS PAGE TO A FRIEND

MT3

metallothionein 3

64 Gene Product Result for
Synonyms: GIF GIFB GRIF ZnMT3
UniProtKB ID: P25713, Q2V574
Gene ID:
Mouse(17751) metallothionein 3
Rat(117038) metallothionein 3
Thale Cress(820771) metallothionein 3
dog(611278) metallothionein 3
cow(613320) metallothionein 3
domestic cat(101081179) metallothionein 3
chicken(770592) metallothionein 3
domestic guinea pig(100716374) metallothionein 3
Domestic Rabbit(100009025) metallothionein 3
Goat(100860760) metallothionein 3
sheep(443168) metallothionein 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013603 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013603 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013603 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005954 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005954 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005954 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005954 Rosetta Predictions human pricing
NM_053968 Rosetta Predictions rat pricing
NM_013603 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005954 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00177231 predicted 289
2 SASI_Hs01_00177232 predicted 340
3 SASI_Hs01_00177233 predicted 343
4 SASI_Hs01_00177234 predicted 288
5 SASI_Hs01_00177235 predicted 301
6 SASI_Hs01_00177236 predicted 289
7 SASI_Hs01_00177237 predicted 293
8 SASI_Hs01_00177238 predicted 345
9 SASI_Hs01_00177239 predicted 353
10 SASI_Hs01_00177240 predicted 541
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053968 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00103690 predicted 106
2 SASI_Rn01_00103691 predicted 126
3 SASI_Rn02_00266944 predicted 264
4 SASI_Rn01_00103693 predicted 250
5 SASI_Rn01_00103695 predicted 135
6 SASI_Rn01_00103697 predicted 201
7 SASI_Rn01_00103698 predicted 273
8 SASI_Rn02_00266945 predicted 136
9 SASI_Rn01_00103699 predicted 106
10 SASI_Rn02_00266946 predicted 269
11 SASI_Rn01_00103692 predicted 206
12 SASI_Rn01_00103694 predicted 204
13 SASI_Rn01_00103696 predicted 209
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013603 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00022356 predicted 122
2 SASI_Mm01_00022357 predicted 269
3 SASI_Mm02_00322348 predicted 152
4 SASI_Mm01_00022359 predicted 266
5 SASI_Mm01_00022360 predicted 193
6 SASI_Mm01_00022361 predicted 280
7 SASI_Mm01_00022362 predicted 190
8 SASI_Mm01_00022363 predicted 267
9 SASI_Mm01_00022364 predicted 272
10 SASI_Mm02_00322349 predicted 100
11 SASI_Mm01_00022358 predicted 270
12 SASI_Mm01_00022365 predicted 174
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013603
MT3 MISSION shRNA Bacterial Glycerol Stock
metallothionein 3
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013603.1-176s21c1
Sequence:CCGGCGGATGTGAGAAGTGTGCCAACTCGAGTTGGCACACTTCTCACATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013603.1-93s21c1
Sequence:CCGGTCCTGCACCTGCTCGGACAAACTCGAGTTTGTCCGAGCAGGTGCAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013603.1-115s21c1
Sequence:CCGGGCAAGTGCAAGGGCTGCAAATCTCGAGATTTGCAGCCCTTGCACTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013603.1-139s21c1
Sequence:CCGGCGAACTGCAAGAAGAGCTGCTCTCGAGAGCAGCTCTTCTTGCAGTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013603.1-200s21c1
Sequence:CCGGCTGTGTGTGCAAAGGTGAAGACTCGAGTCTTCACCTTTGCACACACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013603.1-128s1c1
Sequence:CCGGCTGCAAATGCACGAACTGCAACTCGAGTTGCAGTTCGTGCATTTGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013603
MT3 MISSION shRNA shRNA Plasmid DNA
metallothionein 3
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013603.1-176s21c1
Sequence:CCGGCGGATGTGAGAAGTGTGCCAACTCGAGTTGGCACACTTCTCACATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013603.1-93s21c1
Sequence:CCGGTCCTGCACCTGCTCGGACAAACTCGAGTTTGTCCGAGCAGGTGCAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013603.1-115s21c1
Sequence:CCGGGCAAGTGCAAGGGCTGCAAATCTCGAGATTTGCAGCCCTTGCACTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013603.1-139s21c1
Sequence:CCGGCGAACTGCAAGAAGAGCTGCTCTCGAGAGCAGCTCTTCTTGCAGTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013603.1-200s21c1
Sequence:CCGGCTGTGTGTGCAAAGGTGAAGACTCGAGTCTTCACCTTTGCACACACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013603.1-128s1c1
Sequence:CCGGCTGCAAATGCACGAACTGCAACTCGAGTTGCAGTTCGTGCATTTGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013603
MT3 MISSION shRNA Lentiviral Transduction Particles
metallothionein 3
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013603.1-176s21c1
Sequence:CCGGCGGATGTGAGAAGTGTGCCAACTCGAGTTGGCACACTTCTCACATCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013603.1-93s21c1
Sequence:CCGGTCCTGCACCTGCTCGGACAAACTCGAGTTTGTCCGAGCAGGTGCAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013603.1-115s21c1
Sequence:CCGGGCAAGTGCAAGGGCTGCAAATCTCGAGATTTGCAGCCCTTGCACTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013603.1-139s21c1
Sequence:CCGGCGAACTGCAAGAAGAGCTGCTCTCGAGAGCAGCTCTTCTTGCAGTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013603.1-200s21c1
Sequence:CCGGCTGTGTGTGCAAAGGTGAAGACTCGAGTCTTCACCTTTGCACACACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013603.1-128s1c1
Sequence:CCGGCTGCAAATGCACGAACTGCAACTCGAGTTGCAGTTCGTGCATTTGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005954
MT3 MISSION shRNA Bacterial Glycerol Stock
metallothionein 3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000072599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005954.2-371s1c1
Sequence:CCGGTGCCAAGGACTGTGTGTGCAACTCGAGTTGCACACACAGTCCTTGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005954.2-284s1c1
Sequence:CCGGCGCGGACTCCTGCAAGTGCGACTCGAGTCGCACTTGCAGGAGTCCGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005954.2-289s1c1
Sequence:CCGGACTCCTGCAAGTGCGAGGGATCTCGAGATCCCTCGCACTTGCAGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005954.2-355s1c1
Sequence:CCGGCGGAGTGTGAGAAGTGTGCCACTCGAGTGGCACACTTCTCACACTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005954.2-304s1c1
Sequence:CCGGAGGGATGCAAATGCACCTCCTCTCGAGAGGAGGTGCATTTGCATCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005954
MT3 MISSION shRNA shRNA Plasmid DNA
metallothionein 3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000072599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005954.2-371s1c1
Sequence:CCGGTGCCAAGGACTGTGTGTGCAACTCGAGTTGCACACACAGTCCTTGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005954.2-284s1c1
Sequence:CCGGCGCGGACTCCTGCAAGTGCGACTCGAGTCGCACTTGCAGGAGTCCGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005954.2-289s1c1
Sequence:CCGGACTCCTGCAAGTGCGAGGGATCTCGAGATCCCTCGCACTTGCAGGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005954.2-355s1c1
Sequence:CCGGCGGAGTGTGAGAAGTGTGCCACTCGAGTGGCACACTTCTCACACTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005954.2-304s1c1
Sequence:CCGGAGGGATGCAAATGCACCTCCTCTCGAGAGGAGGTGCATTTGCATCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005954
MT3 MISSION shRNA Lentiviral Transduction Particles
metallothionein 3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000072599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005954.2-371s1c1
Sequence:CCGGTGCCAAGGACTGTGTGTGCAACTCGAGTTGCACACACAGTCCTTGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005954.2-284s1c1
Sequence:CCGGCGCGGACTCCTGCAAGTGCGACTCGAGTCGCACTTGCAGGAGTCCGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005954.2-289s1c1
Sequence:CCGGACTCCTGCAAGTGCGAGGGATCTCGAGATCCCTCGCACTTGCAGGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005954.2-355s1c1
Sequence:CCGGCGGAGTGTGAGAAGTGTGCCACTCGAGTGGCACACTTCTCACACTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005954.2-304s1c1
Sequence:CCGGAGGGATGCAAATGCACCTCCTCTCGAGAGGAGGTGCATTTGCATCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)