EMAIL THIS PAGE TO A FRIEND

MT4

metallothionein 4

52 Gene Product Result for
Synonyms: MT-4 MT-IV MTIV
UniProtKB ID: P47944, Q14DA1
Gene ID:
Mouse(17752) metallothionein 4
Rat(498911) metallothionein 4
Goat(100860767) metallothionein 4
sheep(101118210) metallothionein 4
domestic guinea pig(100728057) metallothionein 4
chicken(396212) metallothionein 4
dog(403769) metallothionein 4
domestic cat(101080928) metallothionein 4
cow(782851) metallothionein 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008631 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008631 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008631 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU186171 MISSION® esiRNA esiRNA targeting mouse Mt4 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032935 Rosetta Predictions human pricing
NM_001126084 Rosetta Predictions rat pricing
NM_008631 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032935 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00360549 predicted 262
2 SASI_Hs01_00177080 predicted 116
3 SASI_Hs01_00177081 predicted 110
4 SASI_Hs02_00360550 predicted 122
5 SASI_Hs01_00177082 predicted 141
6 SASI_Hs01_00177083 predicted 122
7 SASI_Hs01_00177084 predicted 107
8 SASI_Hs02_00360551 predicted 246
9 SASI_Hs01_00177085 predicted 87
10 SASI_Hs01_00177086 predicted 123
11 SASI_Hs01_00177087 predicted 44
12 SASI_Hs01_00177088 predicted 60
13 SASI_Hs01_00177089 predicted 17
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001126084 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00252853 predicted 326
2 SASI_Rn02_00252854 predicted 271
3 SASI_Rn02_00252855 predicted 269
4 SASI_Rn02_00252856 predicted 71
5 SASI_Rn02_00252857 predicted 277
6 SASI_Rn02_00252858 predicted 261
7 SASI_Rn02_00252859 predicted 276
8 SASI_Rn02_00252860 predicted 274
9 SASI_Rn02_00252861 predicted 252
10 SASI_Rn02_00252862 predicted 47
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008631 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00314341 predicted 346
2 SASI_Mm02_00314342 predicted 247
3 SASI_Mm02_00314343 predicted 247
4 SASI_Mm02_00314344 predicted 351
5 SASI_Mm01_00186496 predicted 88
6 SASI_Mm02_00314345 predicted 231
7 SASI_Mm02_00314346 predicted 274
8 SASI_Mm02_00314347 predicted 275
9 SASI_Mm02_00314348 predicted 256
10 SASI_Mm01_00186501 predicted 51
11 SASI_Mm01_00186495 predicted 46
12 SASI_Mm01_00186497 predicted 51
13 SASI_Mm01_00186498 predicted 15
14 SASI_Mm01_00186499 predicted 20
15 SASI_Mm01_00186500 predicted 40
16 SASI_Mm01_00186502 predicted 16
17 SASI_Mm01_00186503 predicted 56
18 SASI_Mm01_00186504 predicted 33
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008631
MT4 MISSION shRNA Bacterial Glycerol Stock
metallothionein 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000248891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008631.2-64s21c1
Sequence:CCGGATGTCTGGAGGGATCTGCATCCTCGAGGATGCAGATCCCTCCAGACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008631.2-220s21c1
Sequence:CCGGTGTCCCTGAAACCCACCTATGCTCGAGCATAGGTGGGTTTCAGGGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008631.2-103s21c1
Sequence:CCGGTGCACAACCTGCAGCTGTAAACTCGAGTTTACAGCTGCAGGTTGTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008631.2-75s21c1
Sequence:CCGGGATCTGCATCTGCGGAGATAACTCGAGTTATCTCCGCAGATGCAGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008631.2-91s21c1
Sequence:CCGGGATAATTGCAAATGCACAACCCTCGAGGGTTGTGCATTTGCAATTATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008631
MT4 MISSION shRNA shRNA Plasmid DNA
metallothionein 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000248891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008631.2-64s21c1
Sequence:CCGGATGTCTGGAGGGATCTGCATCCTCGAGGATGCAGATCCCTCCAGACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008631.2-220s21c1
Sequence:CCGGTGTCCCTGAAACCCACCTATGCTCGAGCATAGGTGGGTTTCAGGGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008631.2-103s21c1
Sequence:CCGGTGCACAACCTGCAGCTGTAAACTCGAGTTTACAGCTGCAGGTTGTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008631.2-75s21c1
Sequence:CCGGGATCTGCATCTGCGGAGATAACTCGAGTTATCTCCGCAGATGCAGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008631.2-91s21c1
Sequence:CCGGGATAATTGCAAATGCACAACCCTCGAGGGTTGTGCATTTGCAATTATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008631
MT4 MISSION shRNA Lentiviral Transduction Particles
metallothionein 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000248891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008631.2-64s21c1
Sequence:CCGGATGTCTGGAGGGATCTGCATCCTCGAGGATGCAGATCCCTCCAGACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008631.2-220s21c1
Sequence:CCGGTGTCCCTGAAACCCACCTATGCTCGAGCATAGGTGGGTTTCAGGGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008631.2-103s21c1
Sequence:CCGGTGCACAACCTGCAGCTGTAAACTCGAGTTTACAGCTGCAGGTTGTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008631.2-75s21c1
Sequence:CCGGGATCTGCATCTGCGGAGATAACTCGAGTTATCTCCGCAGATGCAGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008631.2-91s21c1
Sequence:CCGGGATAATTGCAAATGCACAACCCTCGAGGGTTGTGCATTTGCAATTATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)