EMAIL THIS PAGE TO A FRIEND

MTA1

metastasis associated 1

80 Gene Product Result for
UniProtKB ID: Q13330, A5PLK4, Q86SW2, Q8NFI8, Q96GI8
Gene ID:
Human(9112) Summary: This gene encodes a protein that was identified in a screen for genes expressed in metastatic cells, specifically, mammary adenocarcinoma cell lines. Expression of this gene has been correlated with the metastatic potential of at least two types of carcinomas although it is also expressed in many normal tissues. The role it plays in metastasis is unclear. It was initially thought to be the 70kD component of a nucleosome remodeling deacetylase complex, NuRD, but it is more likely that this component is a different but very similar protein. These two proteins are so closely related, though, that they share the same types of domains. These domains include two DNA binding domains, a dimerization domain, and a domain commonly found in proteins that methylate DNA. The profile and activity of this gene product suggest that it is involved in regulating transcription and that this may be accomplished by chromatin remodeling. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2011]
Mouse(116870) metastasis associated 1
Rat(64520) metastasis associated 1
chicken(429060) metastasis associated 1
domestic cat(101090194) metastasis associated 1
cow(511438) metastasis associated 1
Horse(100146742) metastasis associated 1
dog(480450) metastasis associated 1
domestic guinea pig(100731798) metastasis associated 1
naked mole-rat(101721757) metastasis associated 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV37737 Anti-MTA1 (AB1) antibody produced in rabbit IgG fraction of antiserum horse, zebrafish, mouse, human, rat, guinea pig, rabbit, bovine, canine
western blot pricing
AV37738 Anti-MTA1 (AB2) antibody produced in rabbit IgG fraction of antiserum canine, rabbit, mouse, guinea pig, human, rat, horse
western blot pricing
SAB2500651 Anti-MTA1 antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing
M7693 Anti-MTA1 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunoprecipitation (IP), microarray, western blot pricing
HPA005544 Anti-MTA1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB4503553 Anti-MTA1 antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, western blot pricing
M1320 Monoclonal Anti-MTA1 antibody produced in mouse clone MTA1-213, purified from hybridoma cell culture human, mouse, canine, rat
immunocytochemistry, immunoprecipitation (IP), microarray, western blot pricing
WH0009112M2 Monoclonal Anti-MTA1 antibody produced in mouse clone 4D11, purified immunoglobulin, buffered aqueous solution mouse
ELISA, immunofluorescence, western blot pricing
SAB1404673 Monoclonal Anti-MTA1 antibody produced in mouse clone 4D5, purified immunoglobulin, buffered aqueous solution human, mouse, rat
ELISA, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_054081 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_054081 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_054081 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004689 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004689 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004689 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004689 Rosetta Predictions human pricing
NM_022588 Rosetta Predictions rat pricing
NM_054081 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004689 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00239682 predicted 1105
2 SASI_Hs01_00239683 predicted 608
3 SASI_Hs01_00239684 predicted 785
4 SASI_Hs01_00239685 predicted 1050
5 SASI_Hs02_00338126 predicted 1147
6 SASI_Hs01_00239686 predicted 1270
7 SASI_Hs01_00239687 predicted 945
8 SASI_Hs01_00239688 predicted 794
9 SASI_Hs01_00239689 predicted 1259
10 SASI_Hs01_00239690 predicted 1508
11 SASI_Hs01_00239691 predicted 1934
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022588 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00062153 predicted 378
2 SASI_Rn01_00062154 predicted 1059
3 SASI_Rn01_00062155 predicted 2173
4 SASI_Rn01_00062157 predicted 828
5 SASI_Rn02_00263331 predicted 1148
6 SASI_Rn01_00062158 predicted 1005
7 SASI_Rn02_00263332 predicted 2169
8 SASI_Rn01_00062159 predicted 1184
9 SASI_Rn01_00062160 predicted 2187
10 SASI_Rn01_00062161 predicted 1346
11 SASI_Rn01_00062156 predicted 1098
12 SASI_Rn01_00062162 predicted 874
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_054081 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00174991 predicted 998
2 SASI_Mm01_00174992 predicted 1141
3 SASI_Mm01_00174993 predicted 1049
4 SASI_Mm01_00174994 predicted 2203
5 SASI_Mm01_00174995 predicted 367
6 SASI_Mm01_00174996 predicted 1144
7 SASI_Mm01_00174998 predicted 2005
8 SASI_Mm01_00174999 predicted 858
9 SASI_Mm01_00175000 predicted 466
10 SASI_Mm02_00338008 predicted 1279
11 SASI_Mm01_00174997 predicted 1418
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_054081
VALIDATED
MTA1 MISSION shRNA Bacterial Glycerol Stock
metastasis associated 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000334110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054081.2-212s21c1
Sequence:CCGGCCGCAGGATTGAAGAGCTTAACTCGAGTTAAGCTCTTCAATCCTGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054081.2-1145s21c1
Sequence:CCGGGCAGGTTTATATTCCCAACTACTCGAGTAGTTGGGAATATAAACCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054081.2-691s21c1
Sequence:CCGGCCCACAATCCACTTGTGGATACTCGAGTATCCACAAGTGGATTGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054081.2-863s21c1
Sequence:CCGGGCACAAGAACATCTACGACATCTCGAGATGTCGTAGATGTTCTTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054081.1-174s1c1
Sequence:CCGGCCGCAGGATTGAAGAGCTTAACTCGAGTTAAGCTCTTCAATCCTGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054081.1-653s1c1
Sequence:CCGGCCCACAATCCACTTGTGGATACTCGAGTATCCACAAGTGGATTGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054081.1-1107s1c1
Sequence:CCGGGCAGGTTTATATTCCCAACTACTCGAGTAGTTGGGAATATAAACCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054081.1-825s1c1
Sequence:CCGGGCACAAGAACATCTACGACATCTCGAGATGTCGTAGATGTTCTTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054081.1-1311s1c1
Sequence:CCGGGTGGACATATTGGAAGAAATACTCGAGTATTTCTTCCAATATGTCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_054081
VALIDATED
MTA1 MISSION shRNA shRNA Plasmid DNA
metastasis associated 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000334110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054081.2-212s21c1
Sequence:CCGGCCGCAGGATTGAAGAGCTTAACTCGAGTTAAGCTCTTCAATCCTGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054081.2-1145s21c1
Sequence:CCGGGCAGGTTTATATTCCCAACTACTCGAGTAGTTGGGAATATAAACCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054081.2-691s21c1
Sequence:CCGGCCCACAATCCACTTGTGGATACTCGAGTATCCACAAGTGGATTGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054081.2-863s21c1
Sequence:CCGGGCACAAGAACATCTACGACATCTCGAGATGTCGTAGATGTTCTTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054081.1-174s1c1
Sequence:CCGGCCGCAGGATTGAAGAGCTTAACTCGAGTTAAGCTCTTCAATCCTGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054081.1-653s1c1
Sequence:CCGGCCCACAATCCACTTGTGGATACTCGAGTATCCACAAGTGGATTGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054081.1-1107s1c1
Sequence:CCGGGCAGGTTTATATTCCCAACTACTCGAGTAGTTGGGAATATAAACCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054081.1-825s1c1
Sequence:CCGGGCACAAGAACATCTACGACATCTCGAGATGTCGTAGATGTTCTTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054081.1-1311s1c1
Sequence:CCGGGTGGACATATTGGAAGAAATACTCGAGTATTTCTTCCAATATGTCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_054081
VALIDATED
MTA1 MISSION shRNA Lentiviral Transduction Particles
metastasis associated 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000334110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054081.2-212s21c1
Sequence:CCGGCCGCAGGATTGAAGAGCTTAACTCGAGTTAAGCTCTTCAATCCTGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054081.2-1145s21c1
Sequence:CCGGGCAGGTTTATATTCCCAACTACTCGAGTAGTTGGGAATATAAACCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054081.2-691s21c1
Sequence:CCGGCCCACAATCCACTTGTGGATACTCGAGTATCCACAAGTGGATTGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054081.2-863s21c1
Sequence:CCGGGCACAAGAACATCTACGACATCTCGAGATGTCGTAGATGTTCTTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054081.1-174s1c1
Sequence:CCGGCCGCAGGATTGAAGAGCTTAACTCGAGTTAAGCTCTTCAATCCTGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054081.1-653s1c1
Sequence:CCGGCCCACAATCCACTTGTGGATACTCGAGTATCCACAAGTGGATTGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054081.1-1107s1c1
Sequence:CCGGGCAGGTTTATATTCCCAACTACTCGAGTAGTTGGGAATATAAACCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054081.1-825s1c1
Sequence:CCGGGCACAAGAACATCTACGACATCTCGAGATGTCGTAGATGTTCTTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054081.1-1311s1c1
Sequence:CCGGGTGGACATATTGGAAGAAATACTCGAGTATTTCTTCCAATATGTCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004689
VALIDATED
MTA1 MISSION shRNA Bacterial Glycerol Stock
metastasis associated 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000218670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004689.3-712s21c1
Sequence:GTACCGGAGACATCACCGACTTGTTAAACTCGAGTTTAACAAGTCGGTGATGTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004689.3-248s21c1
Sequence:CCGGCCATACCTGATCCGGAGAATCCTCGAGGATTCTCCGGATCAGGTATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230498    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004689.3-2501s21c1
Sequence:CCGGGGCTAACTTATTCCGAGAATGCTCGAGCATTCTCGGAATAAGTTAGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004689.3-1436s21c1
Sequence:CCGGTGCGCATCTTGTTGGACATATCTCGAGATATGTCCAACAAGATGCGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004689.3-1222s21c1
Sequence:CCGGTGAAGCTGAGAGCAAGTTAAACTCGAGTTTAACTTGCTCTCAGCTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280439    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004689.3-2500s21c1
Sequence:CCGGCGGCTAACTTATTCCGAGAATCTCGAGATTCTCGGAATAAGTTAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013358    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004689.2-2320s1c1
Sequence:CCGGCGGCTAACTTATTCCGAGAATCTCGAGATTCTCGGAATAAGTTAGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004689.2-433s1c1
Sequence:CCGGGCGGGAGGATTTCTTCTTCTACTCGAGTAGAAGAAGAAATCCTCCCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004689.2-1257s1c1
Sequence:CCGGGCGCATCTTGTTGGACATATTCTCGAGAATATGTCCAACAAGATGCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004689.2-1973s1c1
Sequence:CCGGGACGTGTTCTACATGCCCAAACTCGAGTTTGGGCATGTAGAACACGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004689.2-1076s1c1
Sequence:CCGGCCCAACTATAACAAGCCAAATCTCGAGATTTGGCTTGTTATAGTTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004689
VALIDATED
MTA1 MISSION shRNA shRNA Plasmid DNA
metastasis associated 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000218670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004689.3-712s21c1
Sequence:GTACCGGAGACATCACCGACTTGTTAAACTCGAGTTTAACAAGTCGGTGATGTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004689.3-248s21c1
Sequence:CCGGCCATACCTGATCCGGAGAATCCTCGAGGATTCTCCGGATCAGGTATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230498    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004689.3-2501s21c1
Sequence:CCGGGGCTAACTTATTCCGAGAATGCTCGAGCATTCTCGGAATAAGTTAGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004689.3-1436s21c1
Sequence:CCGGTGCGCATCTTGTTGGACATATCTCGAGATATGTCCAACAAGATGCGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004689.3-1222s21c1
Sequence:CCGGTGAAGCTGAGAGCAAGTTAAACTCGAGTTTAACTTGCTCTCAGCTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280439    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004689.3-2500s21c1
Sequence:CCGGCGGCTAACTTATTCCGAGAATCTCGAGATTCTCGGAATAAGTTAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013358    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004689.2-2320s1c1
Sequence:CCGGCGGCTAACTTATTCCGAGAATCTCGAGATTCTCGGAATAAGTTAGCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004689.2-433s1c1
Sequence:CCGGGCGGGAGGATTTCTTCTTCTACTCGAGTAGAAGAAGAAATCCTCCCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004689.2-1257s1c1
Sequence:CCGGGCGCATCTTGTTGGACATATTCTCGAGAATATGTCCAACAAGATGCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004689.2-1973s1c1
Sequence:CCGGGACGTGTTCTACATGCCCAAACTCGAGTTTGGGCATGTAGAACACGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004689.2-1076s1c1
Sequence:CCGGCCCAACTATAACAAGCCAAATCTCGAGATTTGGCTTGTTATAGTTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004689
VALIDATED
MTA1 MISSION shRNA Lentiviral Transduction Particles
metastasis associated 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000218670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004689.3-712s21c1
Sequence:GTACCGGAGACATCACCGACTTGTTAAACTCGAGTTTAACAAGTCGGTGATGTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004689.3-248s21c1
Sequence:CCGGCCATACCTGATCCGGAGAATCCTCGAGGATTCTCCGGATCAGGTATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230498    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004689.3-2501s21c1
Sequence:CCGGGGCTAACTTATTCCGAGAATGCTCGAGCATTCTCGGAATAAGTTAGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004689.3-1436s21c1
Sequence:CCGGTGCGCATCTTGTTGGACATATCTCGAGATATGTCCAACAAGATGCGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004689.3-1222s21c1
Sequence:CCGGTGAAGCTGAGAGCAAGTTAAACTCGAGTTTAACTTGCTCTCAGCTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280439    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004689.3-2500s21c1
Sequence:CCGGCGGCTAACTTATTCCGAGAATCTCGAGATTCTCGGAATAAGTTAGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013358    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004689.2-2320s1c1
Sequence:CCGGCGGCTAACTTATTCCGAGAATCTCGAGATTCTCGGAATAAGTTAGCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004689.2-433s1c1
Sequence:CCGGGCGGGAGGATTTCTTCTTCTACTCGAGTAGAAGAAGAAATCCTCCCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004689.2-1257s1c1
Sequence:CCGGGCGCATCTTGTTGGACATATTCTCGAGAATATGTCCAACAAGATGCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004689.2-1973s1c1
Sequence:CCGGGACGTGTTCTACATGCCCAAACTCGAGTTTGGGCATGTAGAACACGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004689.2-1076s1c1
Sequence:CCGGCCCAACTATAACAAGCCAAATCTCGAGATTTGGCTTGTTATAGTTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)