EMAIL THIS PAGE TO A FRIEND

MTA2

metastasis associated 1 family, member 2

104 Gene Product Result for
Synonyms: MTA1L1 PID
UniProtKB ID: O94776, Q9UQB5
Gene ID:
Human(9219) Summary: This gene encodes a protein that has been identified as a component of NuRD, a nucleosome remodeling deacetylase complex identified in the nucleus of human cells. It shows a very broad expression pattern and is strongly expressed in many tissues. It may represent one member of a small gene family that encode different but related proteins involved either directly or indirectly in transcriptional regulation. Their indirect effects on transcriptional regulation may include chromatin remodeling. It is closely related to another member of this family, a protein that has been correlated with the metastatic potential of certain carcinomas. These two proteins are so closely related that they share the same types of domains. These domains include two DNA binding domains, a dimerization domain, and a domain commonly found in proteins that methylate DNA. One of the proteins known to be a target protein for this gene product is p53. Deacetylation of p53 is correlated with a loss of growth inhibition in transformed cells supporting a connection between these gene family members and metastasis. [provided by RefSeq, May 2011]
Mouse(23942) metastasis-associated gene family, member 2
Rat(361724) metastasis associated 1 family, member 2
Zebrafish(326078) metastasis associated 1 family, member 2
cow(515389) metastasis associated 1 family, member 2
Horse(100063490) metastasis associated 1 family, member 2
domestic cat(101086925) metastasis associated 1 family, member 2
dog(476057) metastasis associated 1 family, member 2
Goat(100861363) metastasis associated 1 family, member 2
sheep(101111404) metastasis associated 1 family, member 2
Domestic Rabbit(100351042) metastasis associated 1 family, member 2
domestic guinea pig(100732932) metastasis associated 1 family, member 2
Gene Class: Deacetylase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV37166 Anti-MTA2 (AB1) antibody produced in rabbit IgG fraction of antiserum human, rat, guinea pig, canine, mouse, horse, bovine, rabbit
western blot pricing
AV38509 Anti-MTA2 (AB2) antibody produced in rabbit IgG fraction of antiserum bovine, horse, rat, rabbit, mouse, human, guinea pig, canine
western blot pricing
AV43599 Anti-MTA2 (AB3) antibody produced in rabbit IgG fraction of antiserum rabbit, guinea pig, rat, horse, mouse, human, canine, bovine
immunohistochemistry, western blot pricing
AV37167 Anti-MTA2 (AB4) antibody produced in rabbit IgG fraction of antiserum human, bovine, guinea pig, zebrafish, rat, horse, mouse, rabbit, canine
western blot pricing
HPA006214 Anti-MTA2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human, mouse, rat
immunofluorescence, immunohistochemistry, western blot pricing
AV35743 Anti-MTA2 antibody produced in rabbit affinity isolated antibody horse, canine, rabbit, guinea pig, human, zebrafish, bovine, rat, mouse
western blot pricing
SAB2103402 Anti-MTA2, (N-terminal) antibody produced in rabbit affinity isolated antibody zebrafish, mouse, rat, canine, human, guinea pig, rabbit, bovine, horse
western blot pricing
M7818 Anti-MTA2/MTA1L1 (PD-17) antibody produced in rabbit 0.5 mg/mL, affinity isolated antibody, buffered aqueous solution human
immunoprecipitation (IP), microarray, western blot pricing
M1194 Anti-MTA2/MTA1L1 (RT-16) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, human, rat
immunofluorescence, immunoprecipitation (IP), western blot pricing
SAB3500446 Anti-PID antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, human, rat
ELISA, immunocytochemistry, immunofluorescence, immunohistochemistry, western blot pricing
SAB1306701 ANTI-PID/MTA2(C-TERMINAL) antibody produced in rabbit purified immunoglobulin, buffered aqueous solution mouse, human
flow cytometry, immunohistochemistry, western blot pricing
M7569 Monoclonal Anti-MTA2 antibody produced in mouse clone MTA2-276, purified immunoglobulin, buffered aqueous solution rat, bovine, human, canine, mouse, monkey, hamster
ELISA, immunocytochemistry, immunoprecipitation (IP), microarray, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004739 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004739 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004739 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011842 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011842 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011842 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004739 siRNAs that have been validated in the lab human pricing
NM_001100740 Rosetta Predictions rat pricing
NM_011842 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004739 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00132819 validated 1729
2 SASI_Hs02_00338220 predicted 814
3 SASI_Hs01_00132820 predicted 1643
4 SASI_Hs01_00132821 predicted 2367
5 SASI_Hs01_00132822 predicted 570
6 SASI_Hs01_00132823 predicted 1665
7 SASI_Hs01_00132824 predicted 569
8 SASI_Hs01_00132826 predicted 1337
9 SASI_Hs01_00132827 predicted 1832
10 SASI_Hs01_00132828 predicted 1235
11 SASI_Hs01_00132825 predicted 549
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100740 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00210438 predicted 819
2 SASI_Rn02_00210439 predicted 2207
3 SASI_Rn02_00210440 predicted 1721
4 SASI_Rn02_00210441 predicted 2216
5 SASI_Rn02_00210442 predicted 385
6 SASI_Rn02_00210443 predicted 464
7 SASI_Rn02_00210444 predicted 720
8 SASI_Rn02_00210445 predicted 2365
9 SASI_Rn02_00210446 predicted 2421
10 SASI_Rn02_00210447 predicted 864
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011842 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00321573 predicted 1154
2 SASI_Mm01_00168549 predicted 1830
3 SASI_Mm02_00321574 predicted 1705
4 SASI_Mm01_00168550 predicted 2107
5 SASI_Mm01_00168552 predicted 2268
6 SASI_Mm01_00168554 predicted 523
7 SASI_Mm01_00168555 predicted 1808
8 SASI_Mm01_00168557 predicted 772
9 SASI_Mm01_00168558 predicted 614
10 SASI_Mm02_00321575 predicted 2418
11 SASI_Mm01_00168551 predicted 1605
12 SASI_Mm01_00168553 predicted 1781
13 SASI_Mm01_00168556 predicted 981
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004739
VALIDATED
MTA2 MISSION shRNA Bacterial Glycerol Stock
metastasis associated 1 family, member 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000013373    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004739.2-2857s1c1
Sequence:CCGGCGGACTTTCCTAATTGGAGTTCTCGAGAACTCCAATTAGGAAAGTCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_004739.2-707s1c1
Sequence:CCGGCCCTCTTGAATGAGACAGATACTCGAGTATCTGTCTCATTCAAGAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004739.2-1822s1c1
Sequence:CCGGCGGCCTTATGCTCCTATCAATCTCGAGATTGATAGGAGCATAAGGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_004739.2-999s1c1
Sequence:CCGGCCTAGATTGTAGCAGCTCCATCTCGAGATGGAGCTGCTACAATCTAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:NM_004739.2-434s1c1
Sequence:CCGGCCAGCAATCCTTACCTGGTTACTCGAGTAACCAGGTAAGGATTGCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004739.2-803s21c1
Sequence:CCGGTCGCTGATCAGGGCGAGATTACTCGAGTAATCTCGCCCTGATCAGCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004739.2-1780s21c1
Sequence:CCGGCGCATGTGCAGGGACCTATTACTCGAGTAATAGGTCCCTGCACATGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232200    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004739.2-2471s21c1
Sequence:CCGGAGGGAGTGAGGAGTGAATTAACTCGAGTTAATTCACTCCTCACTCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004739.2-2291s21c1
Sequence:CCGGAGGTGAAGCCAACGCTGATTGCTCGAGCAATCAGCGTTGGCTTCACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004739.2-1406s21c1
Sequence:CCGGCAAACCCTAACCAGATCATTTCTCGAGAAATGATCTGGTTAGGGTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004739
VALIDATED
MTA2 MISSION shRNA shRNA Plasmid DNA
metastasis associated 1 family, member 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000013373    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004739.2-2857s1c1
Sequence:CCGGCGGACTTTCCTAATTGGAGTTCTCGAGAACTCCAATTAGGAAAGTCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_004739.2-707s1c1
Sequence:CCGGCCCTCTTGAATGAGACAGATACTCGAGTATCTGTCTCATTCAAGAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004739.2-1822s1c1
Sequence:CCGGCGGCCTTATGCTCCTATCAATCTCGAGATTGATAGGAGCATAAGGCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_004739.2-999s1c1
Sequence:CCGGCCTAGATTGTAGCAGCTCCATCTCGAGATGGAGCTGCTACAATCTAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:NM_004739.2-434s1c1
Sequence:CCGGCCAGCAATCCTTACCTGGTTACTCGAGTAACCAGGTAAGGATTGCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004739.2-803s21c1
Sequence:CCGGTCGCTGATCAGGGCGAGATTACTCGAGTAATCTCGCCCTGATCAGCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004739.2-1780s21c1
Sequence:CCGGCGCATGTGCAGGGACCTATTACTCGAGTAATAGGTCCCTGCACATGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232200    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004739.2-2471s21c1
Sequence:CCGGAGGGAGTGAGGAGTGAATTAACTCGAGTTAATTCACTCCTCACTCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004739.2-2291s21c1
Sequence:CCGGAGGTGAAGCCAACGCTGATTGCTCGAGCAATCAGCGTTGGCTTCACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004739.2-1406s21c1
Sequence:CCGGCAAACCCTAACCAGATCATTTCTCGAGAAATGATCTGGTTAGGGTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004739
VALIDATED
MTA2 MISSION shRNA Lentiviral Transduction Particles
metastasis associated 1 family, member 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000013373    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004739.2-2857s1c1
Sequence:CCGGCGGACTTTCCTAATTGGAGTTCTCGAGAACTCCAATTAGGAAAGTCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_004739.2-707s1c1
Sequence:CCGGCCCTCTTGAATGAGACAGATACTCGAGTATCTGTCTCATTCAAGAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004739.2-1822s1c1
Sequence:CCGGCGGCCTTATGCTCCTATCAATCTCGAGATTGATAGGAGCATAAGGCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_004739.2-999s1c1
Sequence:CCGGCCTAGATTGTAGCAGCTCCATCTCGAGATGGAGCTGCTACAATCTAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:NM_004739.2-434s1c1
Sequence:CCGGCCAGCAATCCTTACCTGGTTACTCGAGTAACCAGGTAAGGATTGCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004739.2-803s21c1
Sequence:CCGGTCGCTGATCAGGGCGAGATTACTCGAGTAATCTCGCCCTGATCAGCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004739.2-1780s21c1
Sequence:CCGGCGCATGTGCAGGGACCTATTACTCGAGTAATAGGTCCCTGCACATGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232200    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004739.2-2471s21c1
Sequence:CCGGAGGGAGTGAGGAGTGAATTAACTCGAGTTAATTCACTCCTCACTCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004739.2-2291s21c1
Sequence:CCGGAGGTGAAGCCAACGCTGATTGCTCGAGCAATCAGCGTTGGCTTCACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004739.2-1406s21c1
Sequence:CCGGCAAACCCTAACCAGATCATTTCTCGAGAAATGATCTGGTTAGGGTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011842
VALIDATED
MTA2 MISSION shRNA Bacterial Glycerol Stock
metastasis associated 1 family, member 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000039354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011842.2-1197s1c1
Sequence:CCGGCGGGAAGGATTTCAATGATATCTCGAGATATCATTGAAATCCTTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011842.2-1372s1c1
Sequence:CCGGCCAAACCCTAACCAGATCATTCTCGAGAATGATCTGGTTAGGGTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011842.2-409s1c1
Sequence:CCGGCCTTACCTGGTTAGACGGATTCTCGAGAATCCGTCTAACCAGGTAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011842.2-832s1c1
Sequence:CCGGGCAGAGGGAGAATCAGATAATCTCGAGATTATCTGATTCTCCCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011842.2-1754s1c1
Sequence:CCGGGCCGAGATCTATTACAGCCAACTCGAGTTGGCTGTAATAGATCTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312840    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_011842.3-2664s21c1
Sequence:CCGGGTGTGTGTACCTACCCTATTTCTCGAGAAATAGGGTAGGTACACACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011842.3-1459s21c1
Sequence:CCGGCCAAACCCTAACCAGATCATTCTCGAGAATGATCTGGTTAGGGTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_011842.3-1841s21c1
Sequence:CCGGGCCGAGATCTATTACAGCCAACTCGAGTTGGCTGTAATAGATCTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_011842.3-919s21c1
Sequence:CCGGGCAGAGGGAGAATCAGATAATCTCGAGATTATCTGATTCTCCCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011842.3-1284s21c1
Sequence:CCGGCGGGAAGGATTTCAATGATATCTCGAGATATCATTGAAATCCTTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011842
VALIDATED
MTA2 MISSION shRNA shRNA Plasmid DNA
metastasis associated 1 family, member 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000039354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011842.2-1197s1c1
Sequence:CCGGCGGGAAGGATTTCAATGATATCTCGAGATATCATTGAAATCCTTCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011842.2-1372s1c1
Sequence:CCGGCCAAACCCTAACCAGATCATTCTCGAGAATGATCTGGTTAGGGTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011842.2-409s1c1
Sequence:CCGGCCTTACCTGGTTAGACGGATTCTCGAGAATCCGTCTAACCAGGTAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011842.2-832s1c1
Sequence:CCGGGCAGAGGGAGAATCAGATAATCTCGAGATTATCTGATTCTCCCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011842.2-1754s1c1
Sequence:CCGGGCCGAGATCTATTACAGCCAACTCGAGTTGGCTGTAATAGATCTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312840    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_011842.3-2664s21c1
Sequence:CCGGGTGTGTGTACCTACCCTATTTCTCGAGAAATAGGGTAGGTACACACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011842.3-1459s21c1
Sequence:CCGGCCAAACCCTAACCAGATCATTCTCGAGAATGATCTGGTTAGGGTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_011842.3-1841s21c1
Sequence:CCGGGCCGAGATCTATTACAGCCAACTCGAGTTGGCTGTAATAGATCTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_011842.3-919s21c1
Sequence:CCGGGCAGAGGGAGAATCAGATAATCTCGAGATTATCTGATTCTCCCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011842.3-1284s21c1
Sequence:CCGGCGGGAAGGATTTCAATGATATCTCGAGATATCATTGAAATCCTTCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011842
VALIDATED
MTA2 MISSION shRNA Lentiviral Transduction Particles
metastasis associated 1 family, member 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000039354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011842.2-1197s1c1
Sequence:CCGGCGGGAAGGATTTCAATGATATCTCGAGATATCATTGAAATCCTTCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011842.2-1372s1c1
Sequence:CCGGCCAAACCCTAACCAGATCATTCTCGAGAATGATCTGGTTAGGGTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011842.2-409s1c1
Sequence:CCGGCCTTACCTGGTTAGACGGATTCTCGAGAATCCGTCTAACCAGGTAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011842.2-832s1c1
Sequence:CCGGGCAGAGGGAGAATCAGATAATCTCGAGATTATCTGATTCTCCCTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011842.2-1754s1c1
Sequence:CCGGGCCGAGATCTATTACAGCCAACTCGAGTTGGCTGTAATAGATCTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312840    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_011842.3-2664s21c1
Sequence:CCGGGTGTGTGTACCTACCCTATTTCTCGAGAAATAGGGTAGGTACACACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011842.3-1459s21c1
Sequence:CCGGCCAAACCCTAACCAGATCATTCTCGAGAATGATCTGGTTAGGGTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_011842.3-1841s21c1
Sequence:CCGGGCCGAGATCTATTACAGCCAACTCGAGTTGGCTGTAATAGATCTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_011842.3-919s21c1
Sequence:CCGGGCAGAGGGAGAATCAGATAATCTCGAGATTATCTGATTCTCCCTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011842.3-1284s21c1
Sequence:CCGGCGGGAAGGATTTCAATGATATCTCGAGATATCATTGAAATCCTTCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)