EMAIL THIS PAGE TO A FRIEND

MTA3

metastasis associated 1 family, member 3

161 Gene Product Result for
UniProtKB ID: Q9BTC8, Q9NSP2, Q9ULF4
Gene ID:
Mouse(116871) metastasis associated 3
Rat(100362346) metastasis associated 1 family, member 3
domestic guinea pig(101789244) metastasis associated 1 family, member 3
naked mole-rat(101711233) metastasis associated 1 family, member 3
sheep(101116819) metastasis associated 1 family, member 3
Zebrafish(100003254) metastasis associated 1 family, member 3
cow(512854) metastasis associated 1 family, member 3
Horse(100069316) metastasis associated 1 family, member 3
domestic cat(101093847) metastasis associated 1 family, member 3
dog(475740) metastasis associated 1 family, member 3
chicken(421395) metastasis associated 1 family, member 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_054082 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_054082 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_054082 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_038567 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_038567 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_038567 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020744 Rosetta Predictions human pricing
NM_054082 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020744 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00211921 predicted 564
2 SASI_Hs01_00211922 predicted 1112
3 SASI_Hs01_00211923 predicted 533
4 SASI_Hs01_00211924 predicted 764
5 SASI_Hs01_00211925 predicted 650
6 SASI_Hs01_00211926 predicted 1396
7 SASI_Hs01_00211927 predicted 369
8 SASI_Hs01_00211928 predicted 552
9 SASI_Hs01_00211929 predicted 1208
10 SASI_Hs01_00211930 predicted 722
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_054082 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00135553 predicted 525
2 SASI_Mm01_00135554 predicted 1654
3 SASI_Mm01_00135555 predicted 1047
4 SASI_Mm01_00135556 predicted 1676
5 SASI_Mm01_00135557 predicted 1623
6 SASI_Mm01_00135558 predicted 762
7 SASI_Mm01_00135559 predicted 733
8 SASI_Mm01_00135560 predicted 395
9 SASI_Mm01_00135561 predicted 597
10 SASI_Mm01_00135562 predicted 449
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_054082
VALIDATED
MTA3 MISSION shRNA Bacterial Glycerol Stock
metastasis associated 1 family, member 3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000231171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_054082.1-606s21c1
Sequence:CCGGCACTTACGGATCGACAGATTGCTCGAGCAATCTGTCGATCCGTAAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_054082.1-1002s21c1
Sequence:CCGGACGTGCAGCAGAAGCGCTTAACTCGAGTTAAGCGCTTCTGCTGCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231175    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_054082.1-1911s21c1
Sequence:CCGGTTGACCTCACACGTGCACTTGCTCGAGCAAGTGCACGTGTGAGGTCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_054082.1-1522s21c1
Sequence:CCGGACGGCCGTTTGTTGCTATTAACTCGAGTTAATAGCAACAAACGGCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_054082.1-1631s21c1
Sequence:CCGGTCGTGTATCATTGGGTATTTACTCGAGTAAATACCCAATGATACACGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054082.1-1523s1c1
Sequence:CCGGCGGCCGTTTGTTGCTATTAATCTCGAGATTAATAGCAACAAACGGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054082.1-1662s1c1
Sequence:CCGGCCGCAAAGAAACCTAATGTAACTCGAGTTACATTAGGTTTCTTTGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054082.1-904s1c1
Sequence:CCGGCGGCAAAGATTTCAACGACATCTCGAGATGTCGTTGAAATCTTTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054082.1-406s1c1
Sequence:CCGGCGTGTTGTCATACCTTGACAACTCGAGTTGTCAAGGTATGACAACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081868    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_054082.1-1891s1c1
Sequence:CCGGCGACTTCTTCAAGTGCCCTTTCTCGAGAAAGGGCACTTGAAGAAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_054082
VALIDATED
MTA3 MISSION shRNA shRNA Plasmid DNA
metastasis associated 1 family, member 3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000231171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_054082.1-606s21c1
Sequence:CCGGCACTTACGGATCGACAGATTGCTCGAGCAATCTGTCGATCCGTAAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_054082.1-1002s21c1
Sequence:CCGGACGTGCAGCAGAAGCGCTTAACTCGAGTTAAGCGCTTCTGCTGCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231175    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_054082.1-1911s21c1
Sequence:CCGGTTGACCTCACACGTGCACTTGCTCGAGCAAGTGCACGTGTGAGGTCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_054082.1-1522s21c1
Sequence:CCGGACGGCCGTTTGTTGCTATTAACTCGAGTTAATAGCAACAAACGGCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_054082.1-1631s21c1
Sequence:CCGGTCGTGTATCATTGGGTATTTACTCGAGTAAATACCCAATGATACACGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054082.1-1523s1c1
Sequence:CCGGCGGCCGTTTGTTGCTATTAATCTCGAGATTAATAGCAACAAACGGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054082.1-1662s1c1
Sequence:CCGGCCGCAAAGAAACCTAATGTAACTCGAGTTACATTAGGTTTCTTTGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054082.1-904s1c1
Sequence:CCGGCGGCAAAGATTTCAACGACATCTCGAGATGTCGTTGAAATCTTTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054082.1-406s1c1
Sequence:CCGGCGTGTTGTCATACCTTGACAACTCGAGTTGTCAAGGTATGACAACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081868    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_054082.1-1891s1c1
Sequence:CCGGCGACTTCTTCAAGTGCCCTTTCTCGAGAAAGGGCACTTGAAGAAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_054082
VALIDATED
MTA3 MISSION shRNA Lentiviral Transduction Particles
metastasis associated 1 family, member 3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000231171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_054082.1-606s21c1
Sequence:CCGGCACTTACGGATCGACAGATTGCTCGAGCAATCTGTCGATCCGTAAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_054082.1-1002s21c1
Sequence:CCGGACGTGCAGCAGAAGCGCTTAACTCGAGTTAAGCGCTTCTGCTGCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231175    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_054082.1-1911s21c1
Sequence:CCGGTTGACCTCACACGTGCACTTGCTCGAGCAAGTGCACGTGTGAGGTCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_054082.1-1522s21c1
Sequence:CCGGACGGCCGTTTGTTGCTATTAACTCGAGTTAATAGCAACAAACGGCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_054082.1-1631s21c1
Sequence:CCGGTCGTGTATCATTGGGTATTTACTCGAGTAAATACCCAATGATACACGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054082.1-1523s1c1
Sequence:CCGGCGGCCGTTTGTTGCTATTAATCTCGAGATTAATAGCAACAAACGGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054082.1-1662s1c1
Sequence:CCGGCCGCAAAGAAACCTAATGTAACTCGAGTTACATTAGGTTTCTTTGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054082.1-904s1c1
Sequence:CCGGCGGCAAAGATTTCAACGACATCTCGAGATGTCGTTGAAATCTTTGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054082.1-406s1c1
Sequence:CCGGCGTGTTGTCATACCTTGACAACTCGAGTTGTCAAGGTATGACAACACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081868    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_054082.1-1891s1c1
Sequence:CCGGCGACTTCTTCAAGTGCCCTTTCTCGAGAAAGGGCACTTGAAGAAGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_038567
MTA3 MISSION shRNA Bacterial Glycerol Stock
metastasis associated 1 family, member 3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000016460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_038567.8-1490s1c1
Sequence:CCGGGCTGAGAGTAAACTGAAACAACTCGAGTTGTTTCAGTTTACTCTCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_038567.8-2179s1c1
Sequence:CCGGGCGGATGCTAACAACTCCAAACTCGAGTTTGGAGTTGTTAGCATCCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_038567.8-2090s1c1
Sequence:CCGGGCATGTATCATTGGGTATTTACTCGAGTAAATACCCAATGATACATGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_038567.8-837s1c1
Sequence:CCGGCCCTTCTGAATGAGACAGAATCTCGAGATTCTGTCTCATTCAGAAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_038567.8-1693s1c1
Sequence:CCGGGCAGTGTAGATTATGTGCAATCTCGAGATTGCACATAATCTACACTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_038567
MTA3 MISSION shRNA shRNA Plasmid DNA
metastasis associated 1 family, member 3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000016460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_038567.8-1490s1c1
Sequence:CCGGGCTGAGAGTAAACTGAAACAACTCGAGTTGTTTCAGTTTACTCTCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_038567.8-2179s1c1
Sequence:CCGGGCGGATGCTAACAACTCCAAACTCGAGTTTGGAGTTGTTAGCATCCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_038567.8-2090s1c1
Sequence:CCGGGCATGTATCATTGGGTATTTACTCGAGTAAATACCCAATGATACATGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_038567.8-837s1c1
Sequence:CCGGCCCTTCTGAATGAGACAGAATCTCGAGATTCTGTCTCATTCAGAAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_038567.8-1693s1c1
Sequence:CCGGGCAGTGTAGATTATGTGCAATCTCGAGATTGCACATAATCTACACTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_038567
MTA3 MISSION shRNA Lentiviral Transduction Particles
metastasis associated 1 family, member 3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000016460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_038567.8-1490s1c1
Sequence:CCGGGCTGAGAGTAAACTGAAACAACTCGAGTTGTTTCAGTTTACTCTCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_038567.8-2179s1c1
Sequence:CCGGGCGGATGCTAACAACTCCAAACTCGAGTTTGGAGTTGTTAGCATCCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_038567.8-2090s1c1
Sequence:CCGGGCATGTATCATTGGGTATTTACTCGAGTAAATACCCAATGATACATGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_038567.8-837s1c1
Sequence:CCGGCCCTTCTGAATGAGACAGAATCTCGAGATTCTGTCTCATTCAGAAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_038567.8-1693s1c1
Sequence:CCGGGCAGTGTAGATTATGTGCAATCTCGAGATTGCACATAATCTACACTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)