EMAIL THIS PAGE TO A FRIEND

MTAP

methylthioadenosine phosphorylase

220 Gene Product Result for
Synonyms: BDMF DMSFH DMSMFH LGMBF MSAP c86fus
Gene ID:
Human(4507) Summary: This gene encodes an enzyme that plays a major role in polyamine metabolism and is important for the salvage of both adenine and methionine. The encoded enzyme is deficient in many cancers because this gene and the tumor suppressor p16 gene are co-deleted. Multiple alternatively spliced transcript variants have been described for this gene, but their full-length natures remain unknown. [provided by RefSeq, Jul 2008]
Mouse(66902) methylthioadenosine phosphorylase
Rat(298227) methylthioadenosine phosphorylase
sheep(101104463) methylthioadenosine phosphorylase
naked mole-rat(101700706) methylthioadenosine phosphorylase
domestic guinea pig(100729773) methylthioadenosine phosphorylase
Zebrafish(393526) methylthioadenosine phosphorylase
dog(474729) methylthioadenosine phosphorylase
chicken(431261) methylthioadenosine phosphorylase
domestic cat(101088961) methylthioadenosine phosphorylase
cow(782907) methylthioadenosine phosphorylase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
D5011 5′-Deoxy-5′-(methylthio)adenosine human, mouse, rat pricing
469548 1,1,1-Trifluoro-5,5-dimethyl-2,4-hexanedione 98% mouse pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024433 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_024433 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_024433 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002451 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002451 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002451 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002451 Rosetta Predictions human pricing
NM_001047867 Rosetta Predictions rat pricing
NM_024433 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002451 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00333853 predicted 799
2 SASI_Hs02_00333854 predicted 900
3 SASI_Hs01_00060524 predicted 407
4 SASI_Hs01_00060525 predicted 735
5 SASI_Hs01_00060526 predicted 374
6 SASI_Hs01_00060527 predicted 762
7 SASI_Hs01_00060528 predicted 557
8 SASI_Hs01_00060529 predicted 428
9 SASI_Hs02_00333855 predicted 878
10 SASI_Hs01_00060530 predicted 615
11 SASI_Hs01_00060531 predicted 726
12 SASI_Hs01_00060532 predicted 630
13 SASI_Hs01_00060533 predicted 753
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001047867 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00206337 predicted 609
2 SASI_Rn02_00206338 predicted 225
3 SASI_Rn02_00206339 predicted 558
4 SASI_Rn02_00206340 predicted 353
5 SASI_Rn02_00206341 predicted 683
6 SASI_Rn02_00206342 predicted 266
7 SASI_Rn02_00206343 predicted 257
8 SASI_Rn02_00206344 predicted 871
9 SASI_Rn02_00206345 predicted 785
10 SASI_Rn02_00206346 predicted 841
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024433 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00038782 predicted 833
2 SASI_Mm01_00038783 predicted 499
3 SASI_Mm02_00327751 predicted 926
4 SASI_Mm01_00038784 predicted 684
5 SASI_Mm02_00327752 predicted 431
6 SASI_Mm01_00038785 predicted 215
7 SASI_Mm01_00038786 predicted 217
8 SASI_Mm01_00038787 predicted 855
9 SASI_Mm01_00038788 predicted 389
10 SASI_Mm02_00327753 predicted 383
11 SASI_Mm01_00038789 predicted 992
12 SASI_Mm01_00038790 predicted 746
13 SASI_Mm01_00038791 predicted 522
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024433
VALIDATED
MTAP MISSION shRNA Bacterial Glycerol Stock
methylthioadenosine phosphorylase
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000353373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024433.2-266s21c1
Sequence:CCGGGAAGATAAAGAACGTTGATTGCTCGAGCAATCAACGTTCTTTATCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_024433.2-178s21c1
Sequence:CCGGGCTTGGATGATCCCGAAATTTCTCGAGAAATTTCGGGATCATCCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_024433.2-575s21c1
Sequence:CCGGCCTCATAGAAACTGCTAAGAACTCGAGTTCTTAGCAGTTTCTATGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336196    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_024433.2-1173s21c1
Sequence:CCGGTGTCTCACTTTCCCTATTAAACTCGAGTTTAATAGGGAAAGTGAGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120042    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024433.1-2179s1c1
Sequence:CCGGGCTCTCTTCAACATGGAGAATCTCGAGATTCTCCATGTTGAAGAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024433.1-819s1c1
Sequence:CCGGCCTCACTACTATACCTCAGATCTCGAGATCTGAGGTATAGTAGTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_024433.1-519s1c1
Sequence:CCGGCCTCATAGAAACTGCTAAGAACTCGAGTTCTTAGCAGTTTCTATGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_024433.2-867s21c1
Sequence:CCGGAGTTTACTCCTCACTACTATACTCGAGTATAGTAGTGAGGAGTAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024433.1-603s1c1
Sequence:CCGGCCGGGCAGAAAGCCTTATATTCTCGAGAATATAAGGCTTTCTGCCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_024433.1-122s1c1
Sequence:CCGGGCTTGGATGATCCCGAAATTTCTCGAGAAATTTCGGGATCATCCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024433
VALIDATED
MTAP MISSION shRNA shRNA Plasmid DNA
methylthioadenosine phosphorylase
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000353373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024433.2-266s21c1
Sequence:CCGGGAAGATAAAGAACGTTGATTGCTCGAGCAATCAACGTTCTTTATCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_024433.2-178s21c1
Sequence:CCGGGCTTGGATGATCCCGAAATTTCTCGAGAAATTTCGGGATCATCCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_024433.2-575s21c1
Sequence:CCGGCCTCATAGAAACTGCTAAGAACTCGAGTTCTTAGCAGTTTCTATGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336196    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_024433.2-1173s21c1
Sequence:CCGGTGTCTCACTTTCCCTATTAAACTCGAGTTTAATAGGGAAAGTGAGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120042    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024433.1-2179s1c1
Sequence:CCGGGCTCTCTTCAACATGGAGAATCTCGAGATTCTCCATGTTGAAGAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024433.1-819s1c1
Sequence:CCGGCCTCACTACTATACCTCAGATCTCGAGATCTGAGGTATAGTAGTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_024433.1-519s1c1
Sequence:CCGGCCTCATAGAAACTGCTAAGAACTCGAGTTCTTAGCAGTTTCTATGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_024433.2-867s21c1
Sequence:CCGGAGTTTACTCCTCACTACTATACTCGAGTATAGTAGTGAGGAGTAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024433.1-603s1c1
Sequence:CCGGCCGGGCAGAAAGCCTTATATTCTCGAGAATATAAGGCTTTCTGCCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_024433.1-122s1c1
Sequence:CCGGGCTTGGATGATCCCGAAATTTCTCGAGAAATTTCGGGATCATCCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024433
VALIDATED
MTAP MISSION shRNA Lentiviral Transduction Particles
methylthioadenosine phosphorylase
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000353373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024433.2-266s21c1
Sequence:CCGGGAAGATAAAGAACGTTGATTGCTCGAGCAATCAACGTTCTTTATCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_024433.2-178s21c1
Sequence:CCGGGCTTGGATGATCCCGAAATTTCTCGAGAAATTTCGGGATCATCCAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_024433.2-575s21c1
Sequence:CCGGCCTCATAGAAACTGCTAAGAACTCGAGTTCTTAGCAGTTTCTATGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336196    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_024433.2-1173s21c1
Sequence:CCGGTGTCTCACTTTCCCTATTAAACTCGAGTTTAATAGGGAAAGTGAGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120042    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024433.1-2179s1c1
Sequence:CCGGGCTCTCTTCAACATGGAGAATCTCGAGATTCTCCATGTTGAAGAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024433.1-819s1c1
Sequence:CCGGCCTCACTACTATACCTCAGATCTCGAGATCTGAGGTATAGTAGTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_024433.1-519s1c1
Sequence:CCGGCCTCATAGAAACTGCTAAGAACTCGAGTTCTTAGCAGTTTCTATGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_024433.2-867s21c1
Sequence:CCGGAGTTTACTCCTCACTACTATACTCGAGTATAGTAGTGAGGAGTAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024433.1-603s1c1
Sequence:CCGGCCGGGCAGAAAGCCTTATATTCTCGAGAATATAAGGCTTTCTGCCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_024433.1-122s1c1
Sequence:CCGGGCTTGGATGATCCCGAAATTTCTCGAGAAATTTCGGGATCATCCAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002451
VALIDATED
MTAP MISSION shRNA Bacterial Glycerol Stock
methylthioadenosine phosphorylase
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000256262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002451.3-139s21c1
Sequence:CCGGCCGTGAAGATTGGAATAATTGCTCGAGCAATTATTCCAATCTTCACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_002451.3-327s21c1
Sequence:CCGGGTCAACTACCAGGCGAACATCCTCGAGGATGTTCGCCTGGTAGTTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_002451.3-424s21c1
Sequence:CCGGCCGGCGATATTGTCATTATTGCTCGAGCAATAATGACAATATCGCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_002451.3-755s21c1
Sequence:CCGGTATCGCCATGGCGACAGATTACTCGAGTAATCTGTCGCCATGGCGATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_002451.3-230s21c1
Sequence:CCGGCAAGCCATCTGATGCCTTAATCTCGAGATTAAGGCATCAGATGGCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002451.3-169s21c1
Sequence:CCGGGCCTGGATGATCCAGAAATTTCTCGAGAAATTTCTGGATCATCCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_002451.3-725s21c1
Sequence:CCGGTGCTAAGGAGGCTGGAATTTGCTCGAGCAAATTCCAGCCTCCTTAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256260    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002451.3-3203s21c1
Sequence:CCGGCCTTATGCAAAGCCAATATAACTCGAGTTATATTGGCTTTGCATAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005883    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002451.2-1137s1c1
Sequence:CCGGCCTGAATGATTTAGACAACTTCTCGAGAAGTTGTCTAAATCATTCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002451.2-874s1c1
Sequence:CCGGGCTCACTACCATACCTCAGATCTCGAGATCTGAGGTATGGTAGTGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002451.2-824s1c1
Sequence:CCGGCGGGTCTTAAAGACCCTGAAACTCGAGTTTCAGGGTCTTTAAGACCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002451.2-489s1c1
Sequence:CCGGCCTTCTATGATGGAAGTCATTCTCGAGAATGACTTCCATCATAGAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002451.2-313s1c1
Sequence:CCGGGCACACCATCATGCCTTCAAACTCGAGTTTGAAGGCATGATGGTGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_002451.3-899s21c1
Sequence:CCGGATGGTCAGAAACCCTCCATAACTCGAGTTATGGAGGGTTTCTGACCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256254    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002451.3-2863s21c1
Sequence:CCGGGACTTCCTGATGTAGTATTAACTCGAGTTAATACTACATCAGGAAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002451
VALIDATED
MTAP MISSION shRNA shRNA Plasmid DNA
methylthioadenosine phosphorylase
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000256262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002451.3-139s21c1
Sequence:CCGGCCGTGAAGATTGGAATAATTGCTCGAGCAATTATTCCAATCTTCACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_002451.3-327s21c1
Sequence:CCGGGTCAACTACCAGGCGAACATCCTCGAGGATGTTCGCCTGGTAGTTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_002451.3-424s21c1
Sequence:CCGGCCGGCGATATTGTCATTATTGCTCGAGCAATAATGACAATATCGCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_002451.3-755s21c1
Sequence:CCGGTATCGCCATGGCGACAGATTACTCGAGTAATCTGTCGCCATGGCGATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_002451.3-230s21c1
Sequence:CCGGCAAGCCATCTGATGCCTTAATCTCGAGATTAAGGCATCAGATGGCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002451.3-169s21c1
Sequence:CCGGGCCTGGATGATCCAGAAATTTCTCGAGAAATTTCTGGATCATCCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_002451.3-725s21c1
Sequence:CCGGTGCTAAGGAGGCTGGAATTTGCTCGAGCAAATTCCAGCCTCCTTAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256260    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002451.3-3203s21c1
Sequence:CCGGCCTTATGCAAAGCCAATATAACTCGAGTTATATTGGCTTTGCATAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005883    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002451.2-1137s1c1
Sequence:CCGGCCTGAATGATTTAGACAACTTCTCGAGAAGTTGTCTAAATCATTCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002451.2-874s1c1
Sequence:CCGGGCTCACTACCATACCTCAGATCTCGAGATCTGAGGTATGGTAGTGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002451.2-824s1c1
Sequence:CCGGCGGGTCTTAAAGACCCTGAAACTCGAGTTTCAGGGTCTTTAAGACCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002451.2-489s1c1
Sequence:CCGGCCTTCTATGATGGAAGTCATTCTCGAGAATGACTTCCATCATAGAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002451.2-313s1c1
Sequence:CCGGGCACACCATCATGCCTTCAAACTCGAGTTTGAAGGCATGATGGTGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_002451.3-899s21c1
Sequence:CCGGATGGTCAGAAACCCTCCATAACTCGAGTTATGGAGGGTTTCTGACCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256254    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002451.3-2863s21c1
Sequence:CCGGGACTTCCTGATGTAGTATTAACTCGAGTTAATACTACATCAGGAAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002451
VALIDATED
MTAP MISSION shRNA Lentiviral Transduction Particles
methylthioadenosine phosphorylase
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000256262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002451.3-139s21c1
Sequence:CCGGCCGTGAAGATTGGAATAATTGCTCGAGCAATTATTCCAATCTTCACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_002451.3-327s21c1
Sequence:CCGGGTCAACTACCAGGCGAACATCCTCGAGGATGTTCGCCTGGTAGTTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_002451.3-424s21c1
Sequence:CCGGCCGGCGATATTGTCATTATTGCTCGAGCAATAATGACAATATCGCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_002451.3-755s21c1
Sequence:CCGGTATCGCCATGGCGACAGATTACTCGAGTAATCTGTCGCCATGGCGATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_002451.3-230s21c1
Sequence:CCGGCAAGCCATCTGATGCCTTAATCTCGAGATTAAGGCATCAGATGGCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002451.3-169s21c1
Sequence:CCGGGCCTGGATGATCCAGAAATTTCTCGAGAAATTTCTGGATCATCCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_002451.3-725s21c1
Sequence:CCGGTGCTAAGGAGGCTGGAATTTGCTCGAGCAAATTCCAGCCTCCTTAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256260    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002451.3-3203s21c1
Sequence:CCGGCCTTATGCAAAGCCAATATAACTCGAGTTATATTGGCTTTGCATAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005883    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002451.2-1137s1c1
Sequence:CCGGCCTGAATGATTTAGACAACTTCTCGAGAAGTTGTCTAAATCATTCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002451.2-874s1c1
Sequence:CCGGGCTCACTACCATACCTCAGATCTCGAGATCTGAGGTATGGTAGTGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002451.2-824s1c1
Sequence:CCGGCGGGTCTTAAAGACCCTGAAACTCGAGTTTCAGGGTCTTTAAGACCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002451.2-489s1c1
Sequence:CCGGCCTTCTATGATGGAAGTCATTCTCGAGAATGACTTCCATCATAGAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002451.2-313s1c1
Sequence:CCGGGCACACCATCATGCCTTCAAACTCGAGTTTGAAGGCATGATGGTGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_002451.3-899s21c1
Sequence:CCGGATGGTCAGAAACCCTCCATAACTCGAGTTATGGAGGGTTTCTGACCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256254    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002451.3-2863s21c1
Sequence:CCGGGACTTCCTGATGTAGTATTAACTCGAGTTAATACTACATCAGGAAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)