EMAIL THIS PAGE TO A FRIEND

MTCH1

mitochondrial carrier 1

120 Gene Product Result for
Synonyms: CGI-64 PIG60 PSAP SLC25A49
Gene ID:
Human(23787) Summary: This gene encodes a member of the mitochondrial carrier family. The encoded protein is localized to the mitochondrion inner membrane and induces apoptosis independent of the proapoptotic proteins Bax and Bak. Pseudogenes on chromosomes 6 and 11 have been identified for this gene. Alternatively spliced transcript variants encoding multiple isoforms have been observed. [provided by RefSeq, Oct 2012]
Mouse(56462) mitochondrial carrier homolog 1 (C. elegans)
Rat(294313) mitochondrial carrier 1
chicken(425491) mitochondrial carrier 1
domestic cat(101093522) mitochondrial carrier 1
cow(781257) mitochondrial carrier 1
dog(608507) mitochondrial carrier 1
naked mole-rat(101706976) mitochondrial carrier 1
domestic guinea pig(100724034) mitochondrial carrier 1
sheep(101102940) mitochondrial carrier 1
Gene Class: Apoptosis
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA015971 Anti-MTCH1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
AV47011 Anti-MTCH1 antibody produced in rabbit affinity isolated antibody guinea pig, rat, mouse, rabbit, human, bovine, horse, canine
western blot pricing
SAB2106750 Anti-MTCH1 antibody produced in rabbit affinity isolated antibody human, rabbit, guinea pig, horse, rat
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019880 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019880 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019880 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014341 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014341 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014341 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014341 Rosetta Predictions human pricing
NM_001100833 Rosetta Predictions rat pricing
NM_019880 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014341 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00108285 predicted 405
2 SASI_Hs01_00108286 predicted 742
3 SASI_Hs01_00108287 predicted 1132
4 SASI_Hs01_00108288 predicted 1108
5 SASI_Hs02_00345481 predicted 1098
6 SASI_Hs01_00108289 predicted 590
7 SASI_Hs01_00108290 predicted 1576
8 SASI_Hs02_00345482 predicted 1520
9 SASI_Hs02_00345483 predicted 586
10 SASI_Hs02_00345484 predicted 369
11 SASI_Hs01_00108283 predicted 1590
12 SASI_Hs01_00108284 predicted 1379
13 SASI_Hs01_00108291 predicted 612
14 SASI_Hs01_00108292 predicted 536
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100833 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00210662 predicted 999
2 SASI_Rn02_00210663 predicted 988
3 SASI_Rn02_00210664 predicted 593
4 SASI_Rn02_00210665 predicted 1381
5 SASI_Rn02_00210666 predicted 963
6 SASI_Rn02_00210667 predicted 752
7 SASI_Rn02_00210668 predicted 514
8 SASI_Rn02_00210669 predicted 470
9 SASI_Rn02_00210670 predicted 1552
10 SASI_Rn02_00210671 predicted 645
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019880 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00168419 predicted 1102
2 SASI_Mm01_00168420 predicted 1002
3 SASI_Mm01_00168421 predicted 822
4 SASI_Mm01_00168422 predicted 576
5 SASI_Mm01_00168423 predicted 1381
6 SASI_Mm01_00168424 predicted 671
7 SASI_Mm01_00168425 predicted 1347
8 SASI_Mm01_00168426 predicted 804
9 SASI_Mm02_00325182 predicted 708
10 SASI_Mm01_00168427 predicted 658
11 SASI_Mm01_00168418 predicted 719
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019880
VALIDATED
MTCH1 MISSION shRNA Bacterial Glycerol Stock
mitochondrial carrier 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000353908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019880.3-702s21c1
Sequence:CCGGGAAGGAGACATCGTATGAGATCTCGAGATCTCATACGATGTCTCCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019880.3-825s21c1
Sequence:CCGGGCTGAGTTCTATTGGGAAGATCTCGAGATCTTCCCAATAGAACTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324152    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019880.3-1379s21c1
Sequence:CCGGCCTGGCTTCATGTCCATATTTCTCGAGAAATATGGACATGAAGCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019880.3-865s21c1
Sequence:CCGGCTGGGATTCTTCGTTGGCTTACTCGAGTAAGCCAACGAAGAATCCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019880.2-866s1c1
Sequence:CCGGCTGGGATTCTTCGTTGGCTTACTCGAGTAAGCCAACGAAGAATCCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019880.2-703s1c1
Sequence:CCGGGAAGGAGACATCGTATGAGATCTCGAGATCTCATACGATGTCTCCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019880.2-826s1c1
Sequence:CCGGGCTGAGTTCTATTGGGAAGATCTCGAGATCTTCCCAATAGAACTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114286    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019880.2-1380s1c1
Sequence:CCGGCCTGGCTTCATGTCCATATTTCTCGAGAAATATGGACATGAAGCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019880.2-867s1c1
Sequence:CCGGTGGGATTCTTCGTTGGCTTAACTCGAGTTAAGCCAACGAAGAATCCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019880
VALIDATED
MTCH1 MISSION shRNA shRNA Plasmid DNA
mitochondrial carrier 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000353908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019880.3-702s21c1
Sequence:CCGGGAAGGAGACATCGTATGAGATCTCGAGATCTCATACGATGTCTCCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019880.3-825s21c1
Sequence:CCGGGCTGAGTTCTATTGGGAAGATCTCGAGATCTTCCCAATAGAACTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324152    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019880.3-1379s21c1
Sequence:CCGGCCTGGCTTCATGTCCATATTTCTCGAGAAATATGGACATGAAGCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019880.3-865s21c1
Sequence:CCGGCTGGGATTCTTCGTTGGCTTACTCGAGTAAGCCAACGAAGAATCCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019880.2-866s1c1
Sequence:CCGGCTGGGATTCTTCGTTGGCTTACTCGAGTAAGCCAACGAAGAATCCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019880.2-703s1c1
Sequence:CCGGGAAGGAGACATCGTATGAGATCTCGAGATCTCATACGATGTCTCCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019880.2-826s1c1
Sequence:CCGGGCTGAGTTCTATTGGGAAGATCTCGAGATCTTCCCAATAGAACTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114286    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019880.2-1380s1c1
Sequence:CCGGCCTGGCTTCATGTCCATATTTCTCGAGAAATATGGACATGAAGCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019880.2-867s1c1
Sequence:CCGGTGGGATTCTTCGTTGGCTTAACTCGAGTTAAGCCAACGAAGAATCCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019880
VALIDATED
MTCH1 MISSION shRNA Lentiviral Transduction Particles
mitochondrial carrier 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000353908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019880.3-702s21c1
Sequence:CCGGGAAGGAGACATCGTATGAGATCTCGAGATCTCATACGATGTCTCCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019880.3-825s21c1
Sequence:CCGGGCTGAGTTCTATTGGGAAGATCTCGAGATCTTCCCAATAGAACTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324152    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019880.3-1379s21c1
Sequence:CCGGCCTGGCTTCATGTCCATATTTCTCGAGAAATATGGACATGAAGCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019880.3-865s21c1
Sequence:CCGGCTGGGATTCTTCGTTGGCTTACTCGAGTAAGCCAACGAAGAATCCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019880.2-866s1c1
Sequence:CCGGCTGGGATTCTTCGTTGGCTTACTCGAGTAAGCCAACGAAGAATCCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019880.2-703s1c1
Sequence:CCGGGAAGGAGACATCGTATGAGATCTCGAGATCTCATACGATGTCTCCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019880.2-826s1c1
Sequence:CCGGGCTGAGTTCTATTGGGAAGATCTCGAGATCTTCCCAATAGAACTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114286    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019880.2-1380s1c1
Sequence:CCGGCCTGGCTTCATGTCCATATTTCTCGAGAAATATGGACATGAAGCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019880.2-867s1c1
Sequence:CCGGTGGGATTCTTCGTTGGCTTAACTCGAGTTAAGCCAACGAAGAATCCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014341
VALIDATED
MTCH1 MISSION shRNA Bacterial Glycerol Stock
mitochondrial carrier 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000298689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014341.1-815s21c1
Sequence:CCGGTGCTGGCCCACTTCATCAATGCTCGAGCATTGATGAAGTGGGCCAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_014341.1-1082s21c1
Sequence:CCGGGCCGGGTGTCATCAGGATCATCTCGAGATGATCCTGATGACACCCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294028    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_014341.1-1237s21c1
Sequence:CCGGCGGGCTTCAGTTCCATATTTGCTCGAGCAAATATGGAACTGAAGCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014341.1-418s21c1
Sequence:CCGGGTGCAAGTGGATGGTAAGATACTCGAGTATCTTACCATCCACTTGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014341.1-1000s21c1
Sequence:CCGGCCAGTGTTCAAATCCTGGATTCTCGAGAATCCAGGATTTGAACACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_014341.1-747s1c1
Sequence:CCGGGCTGGGATTCTTCGTTGGATTCTCGAGAATCCAACGAAGAATCCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_014341.1-418s1c1
Sequence:CCGGGTGCAAGTGGATGGTAAGATACTCGAGTATCTTACCATCCACTTGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014341.1-548s1c1
Sequence:CCGGACAAGGATGATATGAAGACTTCTCGAGAAGTCTTCATATCATCCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_014341.1-1082s1c1
Sequence:CCGGGCCGGGTGTCATCAGGATCATCTCGAGATGATCCTGATGACACCCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_014341.1-1000s1c1
Sequence:CCGGCCAGTGTTCAAATCCTGGATTCTCGAGAATCCAGGATTTGAACACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014341
VALIDATED
MTCH1 MISSION shRNA shRNA Plasmid DNA
mitochondrial carrier 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000298689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014341.1-815s21c1
Sequence:CCGGTGCTGGCCCACTTCATCAATGCTCGAGCATTGATGAAGTGGGCCAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_014341.1-1082s21c1
Sequence:CCGGGCCGGGTGTCATCAGGATCATCTCGAGATGATCCTGATGACACCCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294028    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_014341.1-1237s21c1
Sequence:CCGGCGGGCTTCAGTTCCATATTTGCTCGAGCAAATATGGAACTGAAGCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014341.1-418s21c1
Sequence:CCGGGTGCAAGTGGATGGTAAGATACTCGAGTATCTTACCATCCACTTGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014341.1-1000s21c1
Sequence:CCGGCCAGTGTTCAAATCCTGGATTCTCGAGAATCCAGGATTTGAACACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_014341.1-747s1c1
Sequence:CCGGGCTGGGATTCTTCGTTGGATTCTCGAGAATCCAACGAAGAATCCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_014341.1-418s1c1
Sequence:CCGGGTGCAAGTGGATGGTAAGATACTCGAGTATCTTACCATCCACTTGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014341.1-548s1c1
Sequence:CCGGACAAGGATGATATGAAGACTTCTCGAGAAGTCTTCATATCATCCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_014341.1-1082s1c1
Sequence:CCGGGCCGGGTGTCATCAGGATCATCTCGAGATGATCCTGATGACACCCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_014341.1-1000s1c1
Sequence:CCGGCCAGTGTTCAAATCCTGGATTCTCGAGAATCCAGGATTTGAACACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014341
VALIDATED
MTCH1 MISSION shRNA Lentiviral Transduction Particles
mitochondrial carrier 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000298689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014341.1-815s21c1
Sequence:CCGGTGCTGGCCCACTTCATCAATGCTCGAGCATTGATGAAGTGGGCCAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_014341.1-1082s21c1
Sequence:CCGGGCCGGGTGTCATCAGGATCATCTCGAGATGATCCTGATGACACCCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294028    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_014341.1-1237s21c1
Sequence:CCGGCGGGCTTCAGTTCCATATTTGCTCGAGCAAATATGGAACTGAAGCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014341.1-418s21c1
Sequence:CCGGGTGCAAGTGGATGGTAAGATACTCGAGTATCTTACCATCCACTTGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014341.1-1000s21c1
Sequence:CCGGCCAGTGTTCAAATCCTGGATTCTCGAGAATCCAGGATTTGAACACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_014341.1-747s1c1
Sequence:CCGGGCTGGGATTCTTCGTTGGATTCTCGAGAATCCAACGAAGAATCCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_014341.1-418s1c1
Sequence:CCGGGTGCAAGTGGATGGTAAGATACTCGAGTATCTTACCATCCACTTGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014341.1-548s1c1
Sequence:CCGGACAAGGATGATATGAAGACTTCTCGAGAAGTCTTCATATCATCCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_014341.1-1082s1c1
Sequence:CCGGGCCGGGTGTCATCAGGATCATCTCGAGATGATCCTGATGACACCCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_014341.1-1000s1c1
Sequence:CCGGCCAGTGTTCAAATCCTGGATTCTCGAGAATCCAGGATTTGAACACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)