EMAIL THIS PAGE TO A FRIEND

MTCH2

mitochondrial carrier 2

140 Gene Product Result for
Synonyms: MIMP SLC25A50
UniProtKB ID: Q9Y6C9, B2R7L8
Gene ID:
Mouse(56428) mitochondrial carrier homolog 2 (C. elegans)
Rat(295922) mitochondrial carrier 2
sheep(101119669) mitochondrial carrier 2
domestic guinea pig(100731088) mitochondrial carrier 2
naked mole-rat(101696634) mitochondrial carrier 2
Zebrafish(30655) mitochondrial carrier homolog 2
cow(337927) mitochondrial carrier 2
domestic cat(101097417) mitochondrial carrier 2
dog(475977) mitochondrial carrier 2
chicken(395597) mitochondrial carrier 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019758 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019758 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019758 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014342 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014342 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014342 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014342 Rosetta Predictions human pricing
NM_001106488 Rosetta Predictions rat pricing
NM_019758 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014342 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00166868 predicted 754
2 SASI_Hs01_00166870 predicted 388
3 SASI_Hs01_00166871 predicted 397
4 SASI_Hs02_00345485 predicted 361
5 SASI_Hs01_00166872 predicted 1003
6 SASI_Hs01_00166873 predicted 994
7 SASI_Hs01_00166874 predicted 739
8 SASI_Hs01_00166875 predicted 1010
9 SASI_Hs01_00166876 predicted 671
10 SASI_Hs01_00166877 predicted 390
11 SASI_Hs01_00166869 predicted 1020
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106488 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00219458 predicted 890
2 SASI_Rn02_00219459 predicted 786
3 SASI_Rn02_00219460 predicted 416
4 SASI_Rn02_00219461 predicted 700
5 SASI_Rn02_00219462 predicted 320
6 SASI_Rn02_00219463 predicted 764
7 SASI_Rn02_00219464 predicted 277
8 SASI_Rn02_00219465 predicted 741
9 SASI_Rn02_00219466 predicted 375
10 SASI_Rn02_00219467 predicted 665
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019758 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00186905 predicted 443
2 SASI_Mm01_00186906 predicted 1106
3 SASI_Mm01_00186907 predicted 1024
4 SASI_Mm01_00186908 predicted 484
5 SASI_Mm01_00186909 predicted 966
6 SASI_Mm01_00186910 predicted 834
7 SASI_Mm01_00186911 predicted 735
8 SASI_Mm01_00186912 predicted 1014
9 SASI_Mm01_00186913 predicted 813
10 SASI_Mm01_00186914 predicted 859
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019758
VALIDATED
MTCH2 MISSION shRNA Bacterial Glycerol Stock
mitochondrial carrier 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000114236    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019758.2-1385s1c1
Sequence:CCGGCCCAATAAGAAGCAGCTAATTCTCGAGAATTAGCTGCTTCTTATTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019758.2-742s1c1
Sequence:CCGGGCCTATCTCATCAATACCTATCTCGAGATAGGTATTGATGAGATAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019758.2-921s1c1
Sequence:CCGGCCCAATATACACTTCTTGGATCTCGAGATCCAAGAAGTGTATATTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019758.2-249s1c1
Sequence:CCGGTCCTCCAACAATAGGACGAAACTCGAGTTTCGTCCTATTGTTGGAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019758.2-541s1c1
Sequence:CCGGGCTGCTACCCTCATTACACATCTCGAGATGTGTAATGAGGGTAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295557    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019758.2-1430s21c1
Sequence:CCGGGCATACCATGTGGGAGTTTATCTCGAGATAAACTCCCACATGGTATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019758.2-921s21c1
Sequence:CCGGCCCAATATACACTTCTTGGATCTCGAGATCCAAGAAGTGTATATTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019758.2-541s21c1
Sequence:CCGGGCTGCTACCCTCATTACACATCTCGAGATGTGTAATGAGGGTAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019758.2-200s21c1
Sequence:CCGGAGCCGCTCATGTACGTGAAAGCTCGAGCTTTCACGTACATGAGCGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019758.2-742s21c1
Sequence:CCGGGCCTATCTCATCAATACCTATCTCGAGATAGGTATTGATGAGATAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019758
VALIDATED
MTCH2 MISSION shRNA shRNA Plasmid DNA
mitochondrial carrier 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000114236    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019758.2-1385s1c1
Sequence:CCGGCCCAATAAGAAGCAGCTAATTCTCGAGAATTAGCTGCTTCTTATTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019758.2-742s1c1
Sequence:CCGGGCCTATCTCATCAATACCTATCTCGAGATAGGTATTGATGAGATAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019758.2-921s1c1
Sequence:CCGGCCCAATATACACTTCTTGGATCTCGAGATCCAAGAAGTGTATATTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019758.2-249s1c1
Sequence:CCGGTCCTCCAACAATAGGACGAAACTCGAGTTTCGTCCTATTGTTGGAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019758.2-541s1c1
Sequence:CCGGGCTGCTACCCTCATTACACATCTCGAGATGTGTAATGAGGGTAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295557    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019758.2-1430s21c1
Sequence:CCGGGCATACCATGTGGGAGTTTATCTCGAGATAAACTCCCACATGGTATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019758.2-921s21c1
Sequence:CCGGCCCAATATACACTTCTTGGATCTCGAGATCCAAGAAGTGTATATTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019758.2-541s21c1
Sequence:CCGGGCTGCTACCCTCATTACACATCTCGAGATGTGTAATGAGGGTAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019758.2-200s21c1
Sequence:CCGGAGCCGCTCATGTACGTGAAAGCTCGAGCTTTCACGTACATGAGCGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019758.2-742s21c1
Sequence:CCGGGCCTATCTCATCAATACCTATCTCGAGATAGGTATTGATGAGATAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019758
VALIDATED
MTCH2 MISSION shRNA Lentiviral Transduction Particles
mitochondrial carrier 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000114236    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019758.2-1385s1c1
Sequence:CCGGCCCAATAAGAAGCAGCTAATTCTCGAGAATTAGCTGCTTCTTATTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019758.2-742s1c1
Sequence:CCGGGCCTATCTCATCAATACCTATCTCGAGATAGGTATTGATGAGATAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019758.2-921s1c1
Sequence:CCGGCCCAATATACACTTCTTGGATCTCGAGATCCAAGAAGTGTATATTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019758.2-249s1c1
Sequence:CCGGTCCTCCAACAATAGGACGAAACTCGAGTTTCGTCCTATTGTTGGAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019758.2-541s1c1
Sequence:CCGGGCTGCTACCCTCATTACACATCTCGAGATGTGTAATGAGGGTAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295557    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019758.2-1430s21c1
Sequence:CCGGGCATACCATGTGGGAGTTTATCTCGAGATAAACTCCCACATGGTATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019758.2-921s21c1
Sequence:CCGGCCCAATATACACTTCTTGGATCTCGAGATCCAAGAAGTGTATATTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019758.2-541s21c1
Sequence:CCGGGCTGCTACCCTCATTACACATCTCGAGATGTGTAATGAGGGTAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019758.2-200s21c1
Sequence:CCGGAGCCGCTCATGTACGTGAAAGCTCGAGCTTTCACGTACATGAGCGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019758.2-742s21c1
Sequence:CCGGGCCTATCTCATCAATACCTATCTCGAGATAGGTATTGATGAGATAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014342
VALIDATED
MTCH2 MISSION shRNA Bacterial Glycerol Stock
mitochondrial carrier 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000059393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_014342.2-153s1c1
Sequence:CCGGCCTCCAACAATAGGACGAAATCTCGAGATTTCGTCCTATTGTTGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_014342.2-645s1c1
Sequence:CCGGGCCTACCTCGTCAATACCTATCTCGAGATAGGTATTGACGAGGTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014342.2-824s1c1
Sequence:CCGGCCCAATATATACGTCTTGGATCTCGAGATCCAAGACGTATATATTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_014342.2-753s1c1
Sequence:CCGGCCCTTTGTGCTTGTCTCCAATCTCGAGATTGGAGACAAGCACAAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_014342.2-601s1c1
Sequence:CCGGGCCTTCTAGGTGACATCCTTTCTCGAGAAAGGATGTCACCTAGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014342.3-1024s21c1
Sequence:CCGGAGCCGAGGAAATAGCTTATTTCTCGAGAAATAAGCTATTTCCTCGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294027    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014342.3-1558s21c1
Sequence:CCGGCCAGAATCTGACTCCCATTATCTCGAGATAATGGGAGTCAGATTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014342.3-895s21c1
Sequence:CCGGCCCTTTGTGCTTGTCTCCAATCTCGAGATTGGAGACAAGCACAAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014342.3-787s21c1
Sequence:CCGGGCCTACCTCGTCAATACCTATCTCGAGATAGGTATTGACGAGGTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014342.3-743s21c1
Sequence:CCGGGCCTTCTAGGTGACATCCTTTCTCGAGAAAGGATGTCACCTAGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014342
VALIDATED
MTCH2 MISSION shRNA shRNA Plasmid DNA
mitochondrial carrier 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000059393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_014342.2-153s1c1
Sequence:CCGGCCTCCAACAATAGGACGAAATCTCGAGATTTCGTCCTATTGTTGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_014342.2-645s1c1
Sequence:CCGGGCCTACCTCGTCAATACCTATCTCGAGATAGGTATTGACGAGGTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014342.2-824s1c1
Sequence:CCGGCCCAATATATACGTCTTGGATCTCGAGATCCAAGACGTATATATTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_014342.2-753s1c1
Sequence:CCGGCCCTTTGTGCTTGTCTCCAATCTCGAGATTGGAGACAAGCACAAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_014342.2-601s1c1
Sequence:CCGGGCCTTCTAGGTGACATCCTTTCTCGAGAAAGGATGTCACCTAGAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014342.3-1024s21c1
Sequence:CCGGAGCCGAGGAAATAGCTTATTTCTCGAGAAATAAGCTATTTCCTCGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294027    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014342.3-1558s21c1
Sequence:CCGGCCAGAATCTGACTCCCATTATCTCGAGATAATGGGAGTCAGATTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014342.3-895s21c1
Sequence:CCGGCCCTTTGTGCTTGTCTCCAATCTCGAGATTGGAGACAAGCACAAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014342.3-787s21c1
Sequence:CCGGGCCTACCTCGTCAATACCTATCTCGAGATAGGTATTGACGAGGTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014342.3-743s21c1
Sequence:CCGGGCCTTCTAGGTGACATCCTTTCTCGAGAAAGGATGTCACCTAGAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014342
VALIDATED
MTCH2 MISSION shRNA Lentiviral Transduction Particles
mitochondrial carrier 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000059393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_014342.2-153s1c1
Sequence:CCGGCCTCCAACAATAGGACGAAATCTCGAGATTTCGTCCTATTGTTGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_014342.2-645s1c1
Sequence:CCGGGCCTACCTCGTCAATACCTATCTCGAGATAGGTATTGACGAGGTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014342.2-824s1c1
Sequence:CCGGCCCAATATATACGTCTTGGATCTCGAGATCCAAGACGTATATATTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_014342.2-753s1c1
Sequence:CCGGCCCTTTGTGCTTGTCTCCAATCTCGAGATTGGAGACAAGCACAAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_014342.2-601s1c1
Sequence:CCGGGCCTTCTAGGTGACATCCTTTCTCGAGAAAGGATGTCACCTAGAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014342.3-1024s21c1
Sequence:CCGGAGCCGAGGAAATAGCTTATTTCTCGAGAAATAAGCTATTTCCTCGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294027    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014342.3-1558s21c1
Sequence:CCGGCCAGAATCTGACTCCCATTATCTCGAGATAATGGGAGTCAGATTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014342.3-895s21c1
Sequence:CCGGCCCTTTGTGCTTGTCTCCAATCTCGAGATTGGAGACAAGCACAAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014342.3-787s21c1
Sequence:CCGGGCCTACCTCGTCAATACCTATCTCGAGATAGGTATTGACGAGGTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014342.3-743s21c1
Sequence:CCGGGCCTTCTAGGTGACATCCTTTCTCGAGAAAGGATGTCACCTAGAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)