EMAIL THIS PAGE TO A FRIEND

MTCP1

mature T-cell proliferation 1

89 Gene Product Result for
Synonyms: P13MTCP1 p8MTCP1
UniProtKB ID: P56278, Q5HYP2
Gene ID:
Human(4515) Summary: This gene was identified by involvement in some t(X;14) translocations associated with mature T-cell proliferations. This region has a complex gene structure, with a common promoter and 5' exon spliced to two different sets of 3' exons that encode two different proteins. This gene represents the upstream 13 kDa protein that is a member of the TCL1 family. This protein may be involved in leukemogenesis. [provided by RefSeq, Mar 2009]
Mouse(17763) mature T cell proliferation 1
Rat(498814) mature T-cell proliferation 1
dog(492265) mature T-cell proliferation 1
naked mole-rat(101721394) mature T-cell proliferation 1
domestic guinea pig(100720015) mature T-cell proliferation 1
sheep(101104374) mature T-cell proliferation 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001018025 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001018025 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001018025 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010839 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010839 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010839 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001018024 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001018024 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001018024 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_014221 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014221 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014221 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU094591 MISSION® esiRNA esiRNA targeting mouse Mtcp1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001018024 Rosetta Predictions human pricing
NM_001018025 Rosetta Predictions human pricing
NM_014221 Rosetta Predictions human pricing
XM_001070795 Rosetta Predictions rat pricing
XM_574098 Rosetta Predictions rat pricing
NM_001039373 Rosetta Predictions mouse pricing
NM_010839 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001018024 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00174239 predicted 693
2 SASI_Hs01_00174240 predicted 873
3 SASI_Hs01_00174241 predicted 865
4 SASI_Hs01_00174242 predicted 771
5 SASI_Hs01_00174243 predicted 854
6 SASI_Hs01_00174245 predicted 774
7 SASI_Hs01_00174246 predicted 850
8 SASI_Hs01_00174247 predicted 679
9 SASI_Hs01_00174248 predicted 807
10 SASI_Hs02_00306923 predicted 888
11 SASI_Hs01_00174244 predicted 731
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001018025 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00144779 predicted 761
2 SASI_Hs01_00144780 predicted 1276
3 SASI_Hs02_00306924 predicted 766
4 SASI_Hs01_00144781 predicted 1186
5 SASI_Hs01_00144782 predicted 1300
6 SASI_Hs01_00144783 predicted 965
7 SASI_Hs01_00144784 predicted 1164
8 SASI_Hs01_00144785 predicted 1171
9 SASI_Hs01_00144786 predicted 1085
10 SASI_Hs01_00144787 predicted 846
11 SASI_Hs01_00144788 predicted 906
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014221 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00243335 predicted 1534
2 SASI_Hs01_00243336 predicted 1707
3 SASI_Hs01_00243337 predicted 1700
4 SASI_Hs01_00243338 predicted 1608
5 SASI_Hs01_00243339 predicted 1694
6 SASI_Hs01_00243341 predicted 1620
7 SASI_Hs01_00243342 predicted 1689
8 SASI_Hs01_00243343 predicted 1518
9 SASI_Hs01_00243344 predicted 1639
10 SASI_Hs02_00345250 predicted 1720
11 SASI_Hs01_00243340 predicted 1561
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001070795 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00332845 predicted 553
2 SASI_Rn02_00332846 predicted 823
3 SASI_Rn02_00332847 predicted 544
4 SASI_Rn02_00332848 predicted 563
5 SASI_Rn02_00332849 predicted 778
6 SASI_Rn02_00332850 predicted 591
7 SASI_Rn02_00332851 predicted 575
8 SASI_Rn02_00332852 predicted 645
9 SASI_Rn02_00332853 predicted 832
10 SASI_Rn02_00332854 predicted 773
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574098 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00401370 predicted 295
2 SASI_Rn02_00401371 predicted 252
3 SASI_Rn02_00401372 predicted 289
4 SASI_Rn02_00401373 predicted 311
5 SASI_Rn02_00401374 predicted 292
6 SASI_Rn02_00401375 predicted 236
7 SASI_Rn02_00401376 predicted 246
8 SASI_Rn02_00401377 predicted 280
9 SASI_Rn02_00401378 predicted 252
10 SASI_Rn02_00401379 predicted 247
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039373 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00143247 predicted 1167
2 SASI_Mm01_00143248 predicted 622
3 SASI_Mm01_00143249 predicted 1157
4 SASI_Mm01_00143250 predicted 1124
5 SASI_Mm01_00143251 predicted 1165
6 SASI_Mm01_00143252 predicted 822
7 SASI_Mm01_00143253 predicted 866
8 SASI_Mm01_00143254 predicted 1031
9 SASI_Mm01_00143255 predicted 830
10 SASI_Mm01_00143256 predicted 1041
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010839 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00319477 predicted 898
2 SASI_Mm02_00319478 predicted 757
3 SASI_Mm01_00168591 predicted 629
4 SASI_Mm01_00168593 predicted 719
5 SASI_Mm02_00319479 predicted 850
6 SASI_Mm01_00168595 predicted 726
7 SASI_Mm02_00319480 predicted 717
8 SASI_Mm01_00168596 predicted 645
9 SASI_Mm01_00168597 predicted 562
10 SASI_Mm02_00319481 predicted 898
11 SASI_Mm01_00168589 predicted 656
12 SASI_Mm01_00168590 predicted 744
13 SASI_Mm01_00168592 predicted 587
14 SASI_Mm01_00168594 predicted 745
15 SASI_Mm01_00168598 predicted 713
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001018025
MTCP1 MISSION shRNA Bacterial Glycerol Stock
mature T-cell proliferation 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000376739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001018025.3-723s21c1
Sequence:CCGGGTGGAAGAGGAGACGAGTTTCCTCGAGGAAACTCGTCTCCTCTTCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001018025.3-680s21c1
Sequence:CCGGGGGTATCTACCGCGACGAATACTCGAGTATTCGTCGCGGTAGATACCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001018025.3-911s21c1
Sequence:CCGGAGTACAGGAGCTGTTGCTTAACTCGAGTTAAGCAACAGCTCCTGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001018025.3-880s21c1
Sequence:CCGGGGCAGATACAGCATCATTTAACTCGAGTTAAATGATGCTGTATCTGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365696    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001018025.3-1358s21c1
Sequence:CCGGACATCTATTTGTCGCTTATTTCTCGAGAAATAAGCGACAAATAGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001018025.3-791s21c1
Sequence:CCGGTAGGCCAAGTCACCTTCTTACCTCGAGGTAAGAAGGTGACTTGGCCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370979    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001018025.3-957s21c1
Sequence:CCGGGCTGGGATTCTACGAAGATATCTCGAGATATCTTCGTAGAATCCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001018025
MTCP1 MISSION shRNA shRNA Plasmid DNA
mature T-cell proliferation 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000376739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001018025.3-723s21c1
Sequence:CCGGGTGGAAGAGGAGACGAGTTTCCTCGAGGAAACTCGTCTCCTCTTCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001018025.3-680s21c1
Sequence:CCGGGGGTATCTACCGCGACGAATACTCGAGTATTCGTCGCGGTAGATACCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001018025.3-911s21c1
Sequence:CCGGAGTACAGGAGCTGTTGCTTAACTCGAGTTAAGCAACAGCTCCTGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001018025.3-880s21c1
Sequence:CCGGGGCAGATACAGCATCATTTAACTCGAGTTAAATGATGCTGTATCTGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365696    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001018025.3-1358s21c1
Sequence:CCGGACATCTATTTGTCGCTTATTTCTCGAGAAATAAGCGACAAATAGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001018025.3-791s21c1
Sequence:CCGGTAGGCCAAGTCACCTTCTTACCTCGAGGTAAGAAGGTGACTTGGCCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370979    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001018025.3-957s21c1
Sequence:CCGGGCTGGGATTCTACGAAGATATCTCGAGATATCTTCGTAGAATCCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001018025
MTCP1 MISSION shRNA Lentiviral Transduction Particles
mature T-cell proliferation 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000376739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001018025.3-723s21c1
Sequence:CCGGGTGGAAGAGGAGACGAGTTTCCTCGAGGAAACTCGTCTCCTCTTCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001018025.3-680s21c1
Sequence:CCGGGGGTATCTACCGCGACGAATACTCGAGTATTCGTCGCGGTAGATACCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001018025.3-911s21c1
Sequence:CCGGAGTACAGGAGCTGTTGCTTAACTCGAGTTAAGCAACAGCTCCTGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001018025.3-880s21c1
Sequence:CCGGGGCAGATACAGCATCATTTAACTCGAGTTAAATGATGCTGTATCTGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365696    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001018025.3-1358s21c1
Sequence:CCGGACATCTATTTGTCGCTTATTTCTCGAGAAATAAGCGACAAATAGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001018025.3-791s21c1
Sequence:CCGGTAGGCCAAGTCACCTTCTTACCTCGAGGTAAGAAGGTGACTTGGCCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370979    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001018025.3-957s21c1
Sequence:CCGGGCTGGGATTCTACGAAGATATCTCGAGATATCTTCGTAGAATCCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010839
VALIDATED
MTCP1 MISSION shRNA Bacterial Glycerol Stock
mature T-cell proliferation 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000328418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010839.5-727s21c1
Sequence:CCGGTGAAGTCTGGATCCAAGTAAACTCGAGTTTACTTGGATCCAGACTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328417    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010839.5-799s21c1
Sequence:CCGGTTTACTGTCCCTCCTTCAATCCTCGAGGATTGAAGGAGGGACAGTAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010839.5-602s21c1
Sequence:CCGGCAACTATTTGGAATCGAAGTGCTCGAGCACTTCGATTCCAAATAGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010839.5-679s21c1
Sequence:CCGGCTCTTGTCTGCTCAGGATTTGCTCGAGCAAATCCTGAGCAGACAAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010839.5-646s21c1
Sequence:CCGGGTAAGTGTTGTGCTCGATATCCTCGAGGATATCGAGCACAACACTTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120602    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010839.2-824s1c1
Sequence:CCGGGTAGCAGCAAACAGCAAATTACTCGAGTAATTTGCTGTTTGCTGCTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010839.2-629s1c1
Sequence:CCGGCTGTCATCCAAGAACTTCGTACTCGAGTACGAAGTTCTTGGATGACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010839.2-656s1c1
Sequence:CCGGGTGCTCGATATCCCAAAGGAACTCGAGTTCCTTTGGGATATCGAGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010839.2-646s1c1
Sequence:CCGGCGTAAGTGTTGTGCTCGATATCTCGAGATATCGAGCACAACACTTACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010839.2-595s1c1
Sequence:CCGGCAAGCCAACAACTATTTGGAACTCGAGTTCCAAATAGTTGTTGGCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010839
VALIDATED
MTCP1 MISSION shRNA shRNA Plasmid DNA
mature T-cell proliferation 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000328418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010839.5-727s21c1
Sequence:CCGGTGAAGTCTGGATCCAAGTAAACTCGAGTTTACTTGGATCCAGACTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328417    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010839.5-799s21c1
Sequence:CCGGTTTACTGTCCCTCCTTCAATCCTCGAGGATTGAAGGAGGGACAGTAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010839.5-602s21c1
Sequence:CCGGCAACTATTTGGAATCGAAGTGCTCGAGCACTTCGATTCCAAATAGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010839.5-679s21c1
Sequence:CCGGCTCTTGTCTGCTCAGGATTTGCTCGAGCAAATCCTGAGCAGACAAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010839.5-646s21c1
Sequence:CCGGGTAAGTGTTGTGCTCGATATCCTCGAGGATATCGAGCACAACACTTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120602    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010839.2-824s1c1
Sequence:CCGGGTAGCAGCAAACAGCAAATTACTCGAGTAATTTGCTGTTTGCTGCTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010839.2-629s1c1
Sequence:CCGGCTGTCATCCAAGAACTTCGTACTCGAGTACGAAGTTCTTGGATGACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010839.2-656s1c1
Sequence:CCGGGTGCTCGATATCCCAAAGGAACTCGAGTTCCTTTGGGATATCGAGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010839.2-646s1c1
Sequence:CCGGCGTAAGTGTTGTGCTCGATATCTCGAGATATCGAGCACAACACTTACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010839.2-595s1c1
Sequence:CCGGCAAGCCAACAACTATTTGGAACTCGAGTTCCAAATAGTTGTTGGCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010839
VALIDATED
MTCP1 MISSION shRNA Lentiviral Transduction Particles
mature T-cell proliferation 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000328418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010839.5-727s21c1
Sequence:CCGGTGAAGTCTGGATCCAAGTAAACTCGAGTTTACTTGGATCCAGACTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328417    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010839.5-799s21c1
Sequence:CCGGTTTACTGTCCCTCCTTCAATCCTCGAGGATTGAAGGAGGGACAGTAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010839.5-602s21c1
Sequence:CCGGCAACTATTTGGAATCGAAGTGCTCGAGCACTTCGATTCCAAATAGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010839.5-679s21c1
Sequence:CCGGCTCTTGTCTGCTCAGGATTTGCTCGAGCAAATCCTGAGCAGACAAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010839.5-646s21c1
Sequence:CCGGGTAAGTGTTGTGCTCGATATCCTCGAGGATATCGAGCACAACACTTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120602    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010839.2-824s1c1
Sequence:CCGGGTAGCAGCAAACAGCAAATTACTCGAGTAATTTGCTGTTTGCTGCTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010839.2-629s1c1
Sequence:CCGGCTGTCATCCAAGAACTTCGTACTCGAGTACGAAGTTCTTGGATGACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010839.2-656s1c1
Sequence:CCGGGTGCTCGATATCCCAAAGGAACTCGAGTTCCTTTGGGATATCGAGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010839.2-646s1c1
Sequence:CCGGCGTAAGTGTTGTGCTCGATATCTCGAGATATCGAGCACAACACTTACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010839.2-595s1c1
Sequence:CCGGCAAGCCAACAACTATTTGGAACTCGAGTTCCAAATAGTTGTTGGCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001018024
MTCP1 MISSION shRNA Bacterial Glycerol Stock
mature T-cell proliferation 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000344419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001018024.2-680s21c1
Sequence:CCGGGTCATCCAAGAACTGCGTAAGCTCGAGCTTACGCAGTTCTTGGATGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344417    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001018024.2-805s21c1
Sequence:CCGGTGAAGTGCTGCTCCATGTTTCCTCGAGGAAACATGGAGCAGCACTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001018024.2-773s21c1
Sequence:CCGGACACGGAAGTCTGCATCAAAGCTCGAGCTTTGATGCAGACTTCCGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001018024.2-649s21c1
Sequence:CCGGCAACAGCTACATGGAATCAAACTCGAGTTTGATTCCATGTAGCTGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001018024.2-729s21c1
Sequence:CCGGCTGTCGTCTGTTCAGGATTTGCTCGAGCAAATCCTGAACAGACGACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001018024
MTCP1 MISSION shRNA shRNA Plasmid DNA
mature T-cell proliferation 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000344419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001018024.2-680s21c1
Sequence:CCGGGTCATCCAAGAACTGCGTAAGCTCGAGCTTACGCAGTTCTTGGATGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344417    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001018024.2-805s21c1
Sequence:CCGGTGAAGTGCTGCTCCATGTTTCCTCGAGGAAACATGGAGCAGCACTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001018024.2-773s21c1
Sequence:CCGGACACGGAAGTCTGCATCAAAGCTCGAGCTTTGATGCAGACTTCCGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001018024.2-649s21c1
Sequence:CCGGCAACAGCTACATGGAATCAAACTCGAGTTTGATTCCATGTAGCTGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001018024.2-729s21c1
Sequence:CCGGCTGTCGTCTGTTCAGGATTTGCTCGAGCAAATCCTGAACAGACGACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001018024
MTCP1 MISSION shRNA Lentiviral Transduction Particles
mature T-cell proliferation 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000344419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001018024.2-680s21c1
Sequence:CCGGGTCATCCAAGAACTGCGTAAGCTCGAGCTTACGCAGTTCTTGGATGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344417    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001018024.2-805s21c1
Sequence:CCGGTGAAGTGCTGCTCCATGTTTCCTCGAGGAAACATGGAGCAGCACTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001018024.2-773s21c1
Sequence:CCGGACACGGAAGTCTGCATCAAAGCTCGAGCTTTGATGCAGACTTCCGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001018024.2-649s21c1
Sequence:CCGGCAACAGCTACATGGAATCAAACTCGAGTTTGATTCCATGTAGCTGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001018024.2-729s21c1
Sequence:CCGGCTGTCGTCTGTTCAGGATTTGCTCGAGCAAATCCTGAACAGACGACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014221
VALIDATED
MTCP1 MISSION shRNA Bacterial Glycerol Stock
mature T-cell proliferation 1
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000107145    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_014221.3-1743s1c1
Sequence:CCGGCCATGTTTCCACCAAATGAATCTCGAGATTCATTTGGTGGAAACATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_014221.3-1597s1c1
Sequence:CCGGTGTCAGGCTGTCATCCAAGAACTCGAGTTCTTGGATGACAGCCTGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_014221.3-1701s1c1
Sequence:CCGGACGGAAGTCTGCATCAAAGTACTCGAGTACTTTGATGCAGACTTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_014221.3-1543s1c1
Sequence:CCGGCAAGCCTGTGAGATACAGAAACTCGAGTTTCTGTATCTCACAGGCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014221
VALIDATED
MTCP1 MISSION shRNA shRNA Plasmid DNA
mature T-cell proliferation 1
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000107145    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_014221.3-1743s1c1
Sequence:CCGGCCATGTTTCCACCAAATGAATCTCGAGATTCATTTGGTGGAAACATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_014221.3-1597s1c1
Sequence:CCGGTGTCAGGCTGTCATCCAAGAACTCGAGTTCTTGGATGACAGCCTGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_014221.3-1701s1c1
Sequence:CCGGACGGAAGTCTGCATCAAAGTACTCGAGTACTTTGATGCAGACTTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_014221.3-1543s1c1
Sequence:CCGGCAAGCCTGTGAGATACAGAAACTCGAGTTTCTGTATCTCACAGGCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014221
VALIDATED
MTCP1 MISSION shRNA Lentiviral Transduction Particles
mature T-cell proliferation 1
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000107145    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_014221.3-1743s1c1
Sequence:CCGGCCATGTTTCCACCAAATGAATCTCGAGATTCATTTGGTGGAAACATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_014221.3-1597s1c1
Sequence:CCGGTGTCAGGCTGTCATCCAAGAACTCGAGTTCTTGGATGACAGCCTGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_014221.3-1701s1c1
Sequence:CCGGACGGAAGTCTGCATCAAAGTACTCGAGTACTTTGATGCAGACTTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_014221.3-1543s1c1
Sequence:CCGGCAAGCCTGTGAGATACAGAAACTCGAGTTTCTGTATCTCACAGGCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)