EMAIL THIS PAGE TO A FRIEND

MTDH

metadherin

154 Gene Product Result for
Synonyms: 3D3 AEG-1 AEG1 LYRIC LYRIC/3D3
UniProtKB ID: Q86UE4, Q05DH2, Q52QU9, Q6PK07, Q8TCX3
Gene ID:
Mouse(67154) metadherin
Rat(170910) metadherin
chicken(420239) metadherin
cow(509788) metadherin
Horse(100059885) metadherin
dog(612147) metadherin
chicken(101665540) metadherin
chicken(101751823) metadherin
sheep(101107364) metadherin
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AB2989 Anti-Metadherin Antibody clone, from rabbit, purified by affinity chromatography mouse, human
immunocytochemistry, western blot pricing
MABN699 Anti-Metadherin Antibody, clone 2F11C3 clone 2F11C3, from mouse, purified by affinity chromatography human
flow cytometry, immunohistochemistry, western blot pricing
SAB1408186 Anti-MTDH antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
SAB1411625 Anti-MTDH antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
HPA015104 Anti-MTDH antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunofluorescence, immunohistochemistry, western blot pricing
HPA010932 Anti-MTDH antibody produced in rabbit Ab1, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human, rat, mouse
immunofluorescence, immunohistochemistry, western blot pricing
AMAB90763 Monoclonal Anti-MTDH antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL0401, purified immunoglobulin, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
AMAB90762 Monoclonal Anti-MTDH antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL0397, purified immunoglobulin, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026002 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026002 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026002 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_178812 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178812 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178812 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178812 Rosetta Predictions human pricing
NM_133398 Rosetta Predictions rat pricing
NM_026002 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178812 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00175406 predicted 1391
2 SASI_Hs01_00175407 predicted 1130
3 SASI_Hs01_00175408 predicted 857
4 SASI_Hs01_00175409 predicted 926
5 SASI_Hs01_00175410 predicted 1120
6 SASI_Hs01_00175411 predicted 1388
7 SASI_Hs01_00175413 predicted 1010
8 SASI_Hs01_00175414 predicted 1013
9 SASI_Hs01_00175415 predicted 1291
10 SASI_Hs02_00369853 predicted 1418
11 SASI_Hs01_00175412 predicted 1087
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133398 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00117018 predicted 1288
2 SASI_Rn01_00117019 predicted 1055
3 SASI_Rn01_00117020 predicted 1928
4 SASI_Rn01_00117022 predicted 1190
5 SASI_Rn01_00117023 predicted 1099
6 SASI_Rn01_00117024 predicted 1381
7 SASI_Rn01_00117025 predicted 1862
8 SASI_Rn02_00267657 predicted 1118
9 SASI_Rn01_00117026 predicted 1381
10 SASI_Rn01_00117027 predicted 376
11 SASI_Rn01_00117021 predicted 1052
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026002 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00085631 predicted 2495
2 SASI_Mm01_00085632 predicted 1373
3 SASI_Mm01_00085633 predicted 2552
4 SASI_Mm01_00085634 predicted 1056
5 SASI_Mm01_00085635 predicted 1042
6 SASI_Mm01_00085636 predicted 1369
7 SASI_Mm01_00085637 predicted 1396
8 SASI_Mm01_00085638 predicted 2448
9 SASI_Mm01_00085639 predicted 1105
10 SASI_Mm01_00085640 predicted 2328
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026002
VALIDATED
MTDH MISSION shRNA Bacterial Glycerol Stock
metadherin
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000125818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_026002.3-1802s1c1
Sequence:CCGGAGCCATCTATTACCTTATCAACTCGAGTTGATAAGGTAATAGATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313386    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026002.4-2288s21c1
Sequence:CCGGGAACGAGAATGATCGTAATTTCTCGAGAAATTACGATCATTCTCGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_026002.3-1882s1c1
Sequence:CCGGCCCAAGTCAAATGCTAAGCAACTCGAGTTGCTTAGCATTTGACTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_026002.3-871s1c1
Sequence:CCGGCGTGATAAAGTGCTGACTGATCTCGAGATCAGTCAGCACTTTATCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125814    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_026002.3-2313s1c1
Sequence:CCGGGCTGAGGAATAATGAATGGATCTCGAGATCCATTCATTATTCCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_026002.3-1059s1c1
Sequence:CCGGGCAGGTTTCTTCAAGGCTGAACTCGAGTTCAGCCTTGAAGAAACCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026002.4-933s21c1
Sequence:CCGGCGTGATAAAGTGCTGACTGATCTCGAGATCAGTCAGCACTTTATCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026002.4-1944s21c1
Sequence:CCGGCCCAAGTCAAATGCTAAGCAACTCGAGTTGCTTAGCATTTGACTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026002.4-1121s21c1
Sequence:CCGGGCAGGTTTCTTCAAGGCTGAACTCGAGTTCAGCCTTGAAGAAACCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026002.4-1864s21c1
Sequence:CCGGAGCCATCTATTACCTTATCAACTCGAGTTGATAAGGTAATAGATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026002
VALIDATED
MTDH MISSION shRNA shRNA Plasmid DNA
metadherin
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000125818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_026002.3-1802s1c1
Sequence:CCGGAGCCATCTATTACCTTATCAACTCGAGTTGATAAGGTAATAGATGGCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000313386    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026002.4-2288s21c1
Sequence:CCGGGAACGAGAATGATCGTAATTTCTCGAGAAATTACGATCATTCTCGTTCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000125815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_026002.3-1882s1c1
Sequence:CCGGCCCAAGTCAAATGCTAAGCAACTCGAGTTGCTTAGCATTTGACTTGGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000125816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_026002.3-871s1c1
Sequence:CCGGCGTGATAAAGTGCTGACTGATCTCGAGATCAGTCAGCACTTTATCACGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000125814    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_026002.3-2313s1c1
Sequence:CCGGGCTGAGGAATAATGAATGGATCTCGAGATCCATTCATTATTCCTCAGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000125817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_026002.3-1059s1c1
Sequence:CCGGGCAGGTTTCTTCAAGGCTGAACTCGAGTTCAGCCTTGAAGAAACCTGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000312351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026002.4-933s21c1
Sequence:CCGGCGTGATAAAGTGCTGACTGATCTCGAGATCAGTCAGCACTTTATCACGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000312360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026002.4-1944s21c1
Sequence:CCGGCCCAAGTCAAATGCTAAGCAACTCGAGTTGCTTAGCATTTGACTTGGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000312291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026002.4-1121s21c1
Sequence:CCGGGCAGGTTTCTTCAAGGCTGAACTCGAGTTCAGCCTTGAAGAAACCTGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000312352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026002.4-1864s21c1
Sequence:CCGGAGCCATCTATTACCTTATCAACTCGAGTTGATAAGGTAATAGATGGCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026002
VALIDATED
MTDH MISSION shRNA Lentiviral Transduction Particles
metadherin
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000125818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_026002.3-1802s1c1
Sequence:CCGGAGCCATCTATTACCTTATCAACTCGAGTTGATAAGGTAATAGATGGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313386    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026002.4-2288s21c1
Sequence:CCGGGAACGAGAATGATCGTAATTTCTCGAGAAATTACGATCATTCTCGTTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_026002.3-1882s1c1
Sequence:CCGGCCCAAGTCAAATGCTAAGCAACTCGAGTTGCTTAGCATTTGACTTGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_026002.3-871s1c1
Sequence:CCGGCGTGATAAAGTGCTGACTGATCTCGAGATCAGTCAGCACTTTATCACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125814    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_026002.3-2313s1c1
Sequence:CCGGGCTGAGGAATAATGAATGGATCTCGAGATCCATTCATTATTCCTCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_026002.3-1059s1c1
Sequence:CCGGGCAGGTTTCTTCAAGGCTGAACTCGAGTTCAGCCTTGAAGAAACCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026002.4-933s21c1
Sequence:CCGGCGTGATAAAGTGCTGACTGATCTCGAGATCAGTCAGCACTTTATCACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026002.4-1944s21c1
Sequence:CCGGCCCAAGTCAAATGCTAAGCAACTCGAGTTGCTTAGCATTTGACTTGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026002.4-1121s21c1
Sequence:CCGGGCAGGTTTCTTCAAGGCTGAACTCGAGTTCAGCCTTGAAGAAACCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026002.4-1864s21c1
Sequence:CCGGAGCCATCTATTACCTTATCAACTCGAGTTGATAAGGTAATAGATGGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178812
VALIDATED
MTDH MISSION shRNA Bacterial Glycerol Stock
metadherin
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178812.2-947s1c1
Sequence:CCGGCGTGATAAGGTGCTGACTGATCTCGAGATCAGTCAGCACCTTATCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178812.2-1453s1c1
Sequence:CCGGCGATGATGAATGGTCTGGGTTCTCGAGAACCCAGACCATTCATCATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178812.2-980s1c1
Sequence:CCGGGATTCAACTATCCCTGGGATACTCGAGTATCCCAGGGATAGTTGAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_178812.3-1433s21c1
Sequence:CCGGAGCCGTAATCAACCCTATATCCTCGAGGATATAGGGTTGATTACGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151467    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_178812.2-2400s1c1
Sequence:CCGGCGAGGAATAAAGGATTCTGATCTCGAGATCAGAATCCTTTATTCCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151559    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178812.2-3564s1c1
Sequence:CCGGGCCTTATTAATGGACAGCTTTCTCGAGAAAGCTGTCCATTAATAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_178812.2-1965s1c1
Sequence:CCGGCCAAGTCAAATACCAAGCAAACTCGAGTTTGCTTGGTATTTGACTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_178812.2-1940s1c1
Sequence:CCGGCCAATACTACAAGAGACAGATCTCGAGATCTGTCTCTTGTAGTATTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178812.2-1454s1c1
Sequence:CCGGGATGATGAATGGTCTGGGTTACTCGAGTAACCCAGACCATTCATCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178812.2-1027s1c1
Sequence:CCGGGCAACTTACAACCGCATCATTCTCGAGAATGATGCGGTTGTAAGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178812.2-1430s1c1
Sequence:CCGGGTTAGCCGTAATCAACCCTATCTCGAGATAGGGTTGATTACGGCTAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178812.2-1937s1c1
Sequence:CCGGCCGCCAATACTACAAGAGACACTCGAGTGTCTCTTGTAGTATTGGCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178812.3-1965s21c1
Sequence:CCGGCCAAGTCAAATACCAAGCAAACTCGAGTTTGCTTGGTATTTGACTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_178812.3-1940s21c1
Sequence:CCGGCCAATACTACAAGAGACAGATCTCGAGATCTGTCTCTTGTAGTATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322949    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_178812.3-2400s21c1
Sequence:CCGGCGAGGAATAAAGGATTCTGATCTCGAGATCAGAATCCTTTATTCCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_178812.3-947s21c1
Sequence:CCGGCGTGATAAGGTGCTGACTGATCTCGAGATCAGTCAGCACCTTATCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178812
VALIDATED
MTDH MISSION shRNA shRNA Plasmid DNA
metadherin
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178812.2-947s1c1
Sequence:CCGGCGTGATAAGGTGCTGACTGATCTCGAGATCAGTCAGCACCTTATCACGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000155682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178812.2-1453s1c1
Sequence:CCGGCGATGATGAATGGTCTGGGTTCTCGAGAACCCAGACCATTCATCATCGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000152993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178812.2-980s1c1
Sequence:CCGGGATTCAACTATCCCTGGGATACTCGAGTATCCCAGGGATAGTTGAATCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000350650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_178812.3-1433s21c1
Sequence:CCGGAGCCGTAATCAACCCTATATCCTCGAGGATATAGGGTTGATTACGGCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000151467    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_178812.2-2400s1c1
Sequence:CCGGCGAGGAATAAAGGATTCTGATCTCGAGATCAGAATCCTTTATTCCTCGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000151559    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178812.2-3564s1c1
Sequence:CCGGGCCTTATTAATGGACAGCTTTCTCGAGAAAGCTGTCCATTAATAAGGCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000152120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_178812.2-1965s1c1
Sequence:CCGGCCAAGTCAAATACCAAGCAAACTCGAGTTTGCTTGGTATTTGACTTGGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000152352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_178812.2-1940s1c1
Sequence:CCGGCCAATACTACAAGAGACAGATCTCGAGATCTGTCTCTTGTAGTATTGGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000152707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178812.2-1454s1c1
Sequence:CCGGGATGATGAATGGTCTGGGTTACTCGAGTAACCCAGACCATTCATCATCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000153105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178812.2-1027s1c1
Sequence:CCGGGCAACTTACAACCGCATCATTCTCGAGAATGATGCGGTTGTAAGTTGCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000153251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178812.2-1430s1c1
Sequence:CCGGGTTAGCCGTAATCAACCCTATCTCGAGATAGGGTTGATTACGGCTAACTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000156091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178812.2-1937s1c1
Sequence:CCGGCCGCCAATACTACAAGAGACACTCGAGTGTCTCTTGTAGTATTGGCGGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000322874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178812.3-1965s21c1
Sequence:CCGGCCAAGTCAAATACCAAGCAAACTCGAGTTTGCTTGGTATTTGACTTGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000322947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_178812.3-1940s21c1
Sequence:CCGGCCAATACTACAAGAGACAGATCTCGAGATCTGTCTCTTGTAGTATTGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000322949    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_178812.3-2400s21c1
Sequence:CCGGCGAGGAATAAAGGATTCTGATCTCGAGATCAGAATCCTTTATTCCTCGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000322872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_178812.3-947s21c1
Sequence:CCGGCGTGATAAGGTGCTGACTGATCTCGAGATCAGTCAGCACCTTATCACGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178812
VALIDATED
MTDH MISSION shRNA Lentiviral Transduction Particles
metadherin
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000155813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178812.2-947s1c1
Sequence:CCGGCGTGATAAGGTGCTGACTGATCTCGAGATCAGTCAGCACCTTATCACGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178812.2-1453s1c1
Sequence:CCGGCGATGATGAATGGTCTGGGTTCTCGAGAACCCAGACCATTCATCATCGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178812.2-980s1c1
Sequence:CCGGGATTCAACTATCCCTGGGATACTCGAGTATCCCAGGGATAGTTGAATCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_178812.3-1433s21c1
Sequence:CCGGAGCCGTAATCAACCCTATATCCTCGAGGATATAGGGTTGATTACGGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151467    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_178812.2-2400s1c1
Sequence:CCGGCGAGGAATAAAGGATTCTGATCTCGAGATCAGAATCCTTTATTCCTCGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151559    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178812.2-3564s1c1
Sequence:CCGGGCCTTATTAATGGACAGCTTTCTCGAGAAAGCTGTCCATTAATAAGGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_178812.2-1965s1c1
Sequence:CCGGCCAAGTCAAATACCAAGCAAACTCGAGTTTGCTTGGTATTTGACTTGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_178812.2-1940s1c1
Sequence:CCGGCCAATACTACAAGAGACAGATCTCGAGATCTGTCTCTTGTAGTATTGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178812.2-1454s1c1
Sequence:CCGGGATGATGAATGGTCTGGGTTACTCGAGTAACCCAGACCATTCATCATCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178812.2-1027s1c1
Sequence:CCGGGCAACTTACAACCGCATCATTCTCGAGAATGATGCGGTTGTAAGTTGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178812.2-1430s1c1
Sequence:CCGGGTTAGCCGTAATCAACCCTATCTCGAGATAGGGTTGATTACGGCTAACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178812.2-1937s1c1
Sequence:CCGGCCGCCAATACTACAAGAGACACTCGAGTGTCTCTTGTAGTATTGGCGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178812.3-1965s21c1
Sequence:CCGGCCAAGTCAAATACCAAGCAAACTCGAGTTTGCTTGGTATTTGACTTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_178812.3-1940s21c1
Sequence:CCGGCCAATACTACAAGAGACAGATCTCGAGATCTGTCTCTTGTAGTATTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322949    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_178812.3-2400s21c1
Sequence:CCGGCGAGGAATAAAGGATTCTGATCTCGAGATCAGAATCCTTTATTCCTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_178812.3-947s21c1
Sequence:CCGGCGTGATAAGGTGCTGACTGATCTCGAGATCAGTCAGCACCTTATCACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)