EMAIL THIS PAGE TO A FRIEND

MTERF

mitochondrial transcription termination factor

66 Gene Product Result for
UniProtKB ID: Q99551, A4D1E3, Q32NF8, Q53H51, Q9BVR7
Gene ID:
Human(7978) Summary: This gene encodes a mitochondrial transcription termination factor. This protein participates in attenuating transcription from the mitochondrial genome; this attenuation allows higher levels of expression of 16S ribosomal RNA relative to the tRNA gene downstream. The product of this gene has three leucine zipper motifs bracketed by two basic domains that are all required for DNA binding. There is evidence that, for this protein, the zippers participate in intramolecular interactions that establish the three-dimensional structure required for DNA binding. [provided by RefSeq, Jul 2008]
Mouse(545725) mitochondrial transcription termination factor
Rat(85261) mitochondrial transcription termination factor
sheep(101109695) mitochondrial transcription termination factor
naked mole-rat(101726599) mitochondrial transcription termination factor
domestic guinea pig(100716389) mitochondrial transcription termination factor
domestic cat(101085280) mitochondrial transcription termination factor
dog(100684053) mitochondrial transcription termination factor
cow(522191) mitochondrial transcription termination factor
cow(784618) transcription termination factor, mitochondrial-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006980 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006980 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006980 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172135 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172135 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172135 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001013023 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001013023 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001013023 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006980 Rosetta Predictions human pricing
NM_053499 Rosetta Predictions rat pricing
NM_001013023 Rosetta Predictions mouse pricing
NM_172135 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006980 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00060735 predicted 588
2 SASI_Hs01_00060736 predicted 338
3 SASI_Hs01_00060737 predicted 833
4 SASI_Hs01_00060738 predicted 510
5 SASI_Hs01_00060739 predicted 643
6 SASI_Hs01_00060740 predicted 394
7 SASI_Hs01_00060741 predicted 749
8 SASI_Hs01_00060742 predicted 652
9 SASI_Hs01_00060743 predicted 684
10 SASI_Hs02_00342712 predicted 997
11 SASI_Hs01_00060734 predicted 744
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053499 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00115867 predicted 1217
2 SASI_Rn01_00115868 predicted 613
3 SASI_Rn01_00115869 predicted 690
4 SASI_Rn01_00115870 predicted 491
5 SASI_Rn01_00115871 predicted 688
6 SASI_Rn02_00266107 predicted 1014
7 SASI_Rn01_00115873 predicted 788
8 SASI_Rn01_00115874 predicted 678
9 SASI_Rn01_00115875 predicted 1117
10 SASI_Rn01_00115876 predicted 1040
11 SASI_Rn01_00115872 predicted 498
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013023 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00093828 predicted 553
2 SASI_Mm02_00287144 predicted 533
3 SASI_Mm01_00093829 predicted 433
4 SASI_Mm02_00287145 predicted 389
5 SASI_Mm01_00093830 predicted 273
6 SASI_Mm01_00093834 predicted 471
7 SASI_Mm02_00287146 predicted 652
8 SASI_Mm01_00093835 predicted 578
9 SASI_Mm02_00287147 predicted 584
10 SASI_Mm01_00093837 predicted 371
11 SASI_Mm01_00093831 predicted 467
12 SASI_Mm01_00093832 predicted 621
13 SASI_Mm01_00093833 predicted 436
14 SASI_Mm01_00093836 predicted 263
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172135 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00042013 predicted 527
2 SASI_Mm02_00343676 predicted 519
3 SASI_Mm01_00042014 predicted 413
4 SASI_Mm02_00343677 predicted 368
5 SASI_Mm01_00042015 predicted 252
6 SASI_Mm01_00042019 predicted 455
7 SASI_Mm02_00343678 predicted 634
8 SASI_Mm01_00042020 predicted 558
9 SASI_Mm02_00343679 predicted 567
10 SASI_Mm01_00042022 predicted 351
11 SASI_Mm01_00042016 predicted 463
12 SASI_Mm01_00042017 predicted 616
13 SASI_Mm01_00042018 predicted 441
14 SASI_Mm01_00042021 predicted 263
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006980
MTERF MISSION shRNA Bacterial Glycerol Stock
mitochondrial transcription termination factor
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000416345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006980.3-313s21c1
Sequence:CCGGACTTACTATGGGAGTAGATATCTCGAGATATCTACTCCCATAGTAAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415931    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006980.3-1401s21c1
Sequence:CCGGTACTTTGGAGGGCCTAATATACTCGAGTATATTAGGCCCTCCAAAGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006980.2-920s1c1
Sequence:CCGGCCTAGACCTTTCCAATGACTACTCGAGTAGTCATTGGAAAGGTCTAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006980.2-440s1c1
Sequence:CCGGCGCTAGCATCATATCAAGATACTCGAGTATCTTGATATGATGCTAGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006980.2-643s1c1
Sequence:CCGGCCCGTAAATGCCTTTGTCGATCTCGAGATCGACAAAGGCATTTACGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006980.2-152s1c1
Sequence:CCGGCCTCTGGCATATGAGAAATAACTCGAGTTATTTCTCATATGCCAGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006980
MTERF MISSION shRNA shRNA Plasmid DNA
mitochondrial transcription termination factor
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000416345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006980.3-313s21c1
Sequence:CCGGACTTACTATGGGAGTAGATATCTCGAGATATCTACTCCCATAGTAAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415931    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006980.3-1401s21c1
Sequence:CCGGTACTTTGGAGGGCCTAATATACTCGAGTATATTAGGCCCTCCAAAGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006980.2-920s1c1
Sequence:CCGGCCTAGACCTTTCCAATGACTACTCGAGTAGTCATTGGAAAGGTCTAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006980.2-440s1c1
Sequence:CCGGCGCTAGCATCATATCAAGATACTCGAGTATCTTGATATGATGCTAGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006980.2-643s1c1
Sequence:CCGGCCCGTAAATGCCTTTGTCGATCTCGAGATCGACAAAGGCATTTACGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006980.2-152s1c1
Sequence:CCGGCCTCTGGCATATGAGAAATAACTCGAGTTATTTCTCATATGCCAGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006980
MTERF MISSION shRNA Lentiviral Transduction Particles
mitochondrial transcription termination factor
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000416345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006980.3-313s21c1
Sequence:CCGGACTTACTATGGGAGTAGATATCTCGAGATATCTACTCCCATAGTAAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415931    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006980.3-1401s21c1
Sequence:CCGGTACTTTGGAGGGCCTAATATACTCGAGTATATTAGGCCCTCCAAAGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006980.2-920s1c1
Sequence:CCGGCCTAGACCTTTCCAATGACTACTCGAGTAGTCATTGGAAAGGTCTAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006980.2-440s1c1
Sequence:CCGGCGCTAGCATCATATCAAGATACTCGAGTATCTTGATATGATGCTAGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006980.2-643s1c1
Sequence:CCGGCCCGTAAATGCCTTTGTCGATCTCGAGATCGACAAAGGCATTTACGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006980.2-152s1c1
Sequence:CCGGCCTCTGGCATATGAGAAATAACTCGAGTTATTTCTCATATGCCAGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172135
MTERF MISSION shRNA Bacterial Glycerol Stock
mitochondrial transcription termination factor
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000120287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172135.1-411s1c1
Sequence:CCGGCACTCCTGAAAGTCTTTCAAACTCGAGTTTGAAAGACTTTCAGGAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172135.1-234s1c1
Sequence:CCGGGCTGAGCAACTTAGTCACCATCTCGAGATGGTGACTAAGTTGCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172135.1-157s1c1
Sequence:CCGGTCGATTTCATTCAGGCCGTTTCTCGAGAAACGGCCTGAATGAAATCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172135.1-1162s1c1
Sequence:CCGGCAGAGAAGATATGAAGCTAAACTCGAGTTTAGCTTCATATCTTCTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172135.1-858s1c1
Sequence:CCGGCCTTTCCAATGACTGTACCAACTCGAGTTGGTACAGTCATTGGAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172135
MTERF MISSION shRNA shRNA Plasmid DNA
mitochondrial transcription termination factor
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000120287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172135.1-411s1c1
Sequence:CCGGCACTCCTGAAAGTCTTTCAAACTCGAGTTTGAAAGACTTTCAGGAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172135.1-234s1c1
Sequence:CCGGGCTGAGCAACTTAGTCACCATCTCGAGATGGTGACTAAGTTGCTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172135.1-157s1c1
Sequence:CCGGTCGATTTCATTCAGGCCGTTTCTCGAGAAACGGCCTGAATGAAATCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172135.1-1162s1c1
Sequence:CCGGCAGAGAAGATATGAAGCTAAACTCGAGTTTAGCTTCATATCTTCTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172135.1-858s1c1
Sequence:CCGGCCTTTCCAATGACTGTACCAACTCGAGTTGGTACAGTCATTGGAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172135
MTERF MISSION shRNA Lentiviral Transduction Particles
mitochondrial transcription termination factor
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000120287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172135.1-411s1c1
Sequence:CCGGCACTCCTGAAAGTCTTTCAAACTCGAGTTTGAAAGACTTTCAGGAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172135.1-234s1c1
Sequence:CCGGGCTGAGCAACTTAGTCACCATCTCGAGATGGTGACTAAGTTGCTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172135.1-157s1c1
Sequence:CCGGTCGATTTCATTCAGGCCGTTTCTCGAGAAACGGCCTGAATGAAATCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172135.1-1162s1c1
Sequence:CCGGCAGAGAAGATATGAAGCTAAACTCGAGTTTAGCTTCATATCTTCTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172135.1-858s1c1
Sequence:CCGGCCTTTCCAATGACTGTACCAACTCGAGTTGGTACAGTCATTGGAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013023
MTERF MISSION shRNA Bacterial Glycerol Stock
mitochondrial transcription termination factor
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000120271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013023.1-1176s1c1
Sequence:CCGGGAAGCTAAACTGAAGAGATTACTCGAGTAATCTCTTCAGTTTAGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013023.1-160s1c1
Sequence:CCGGCGATTTCATTCAGGCCGTTTACTCGAGTAAACGGCCTGAATGAAATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013023.1-562s1c1
Sequence:CCGGGCTCTGTTGGATTGACTCATACTCGAGTATGAGTCAATCCAACAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013023.1-412s1c1
Sequence:CCGGGCACTCCTGAAAGTCTTTCAACTCGAGTTGAAAGACTTTCAGGAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120267    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013023.1-1212s1c1
Sequence:CCGGGCAGGAGGAGTAGCAGGCAATCTCGAGATTGCCTGCTACTCCTCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013023
MTERF MISSION shRNA shRNA Plasmid DNA
mitochondrial transcription termination factor
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000120271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013023.1-1176s1c1
Sequence:CCGGGAAGCTAAACTGAAGAGATTACTCGAGTAATCTCTTCAGTTTAGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013023.1-160s1c1
Sequence:CCGGCGATTTCATTCAGGCCGTTTACTCGAGTAAACGGCCTGAATGAAATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013023.1-562s1c1
Sequence:CCGGGCTCTGTTGGATTGACTCATACTCGAGTATGAGTCAATCCAACAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013023.1-412s1c1
Sequence:CCGGGCACTCCTGAAAGTCTTTCAACTCGAGTTGAAAGACTTTCAGGAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120267    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013023.1-1212s1c1
Sequence:CCGGGCAGGAGGAGTAGCAGGCAATCTCGAGATTGCCTGCTACTCCTCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013023
MTERF MISSION shRNA Lentiviral Transduction Particles
mitochondrial transcription termination factor
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000120271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013023.1-1176s1c1
Sequence:CCGGGAAGCTAAACTGAAGAGATTACTCGAGTAATCTCTTCAGTTTAGCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013023.1-160s1c1
Sequence:CCGGCGATTTCATTCAGGCCGTTTACTCGAGTAAACGGCCTGAATGAAATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013023.1-562s1c1
Sequence:CCGGGCTCTGTTGGATTGACTCATACTCGAGTATGAGTCAATCCAACAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013023.1-412s1c1
Sequence:CCGGGCACTCCTGAAAGTCTTTCAACTCGAGTTGAAAGACTTTCAGGAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120267    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013023.1-1212s1c1
Sequence:CCGGGCAGGAGGAGTAGCAGGCAATCTCGAGATTGCCTGCTACTCCTCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)