EMAIL THIS PAGE TO A FRIEND

MTERFD1

MTERF domain containing 1

57 Gene Product Result for
Synonyms: mTERF3
UniProtKB ID: Q96E29, Q9Y301
Gene ID:
Mouse(66410) MTERF domain containing 1
Rat(299514) MTERF domain containing 1
Zebrafish(436888) MTERF domain containing 1
domestic cat(101090841) MTERF domain containing 1
Horse(100055471) MTERF domain containing 1
cow(526138) MTERF domain containing 1
chicken(420237) MTERF domain containing 1
dog(100684270) MTERF domain containing 1
domestic guinea pig(100724442) MTERF domain containing 1
naked mole-rat(101707951) MTERF domain containing 1
sheep(101108318) MTERF domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA002966 Anti-MTERF3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB3500828 Anti-MTERFD1 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, mouse
ELISA, immunocytochemistry, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025547 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025547 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025547 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015942 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015942 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015942 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015942 Rosetta Predictions human pricing
NM_199387 Rosetta Predictions rat pricing
NM_025547 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015942 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00106846 predicted 884
2 SASI_Hs01_00106847 predicted 567
3 SASI_Hs01_00106848 predicted 1057
4 SASI_Hs02_00348579 predicted 546
5 SASI_Hs01_00106849 predicted 1113
6 SASI_Hs01_00106850 predicted 1030
7 SASI_Hs02_00348580 predicted 880
8 SASI_Hs01_00106851 predicted 205
9 SASI_Hs01_00106852 predicted 202
10 SASI_Hs02_00348581 predicted 499
11 SASI_Hs01_00106853 predicted 836
12 SASI_Hs01_00106854 predicted 851
13 SASI_Hs01_00106855 predicted 1012
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199387 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00046568 predicted 1150
2 SASI_Rn01_00046569 predicted 493
3 SASI_Rn01_00046570 predicted 672
4 SASI_Rn01_00046571 predicted 584
5 SASI_Rn01_00046572 predicted 1142
6 SASI_Rn01_00046573 predicted 484
7 SASI_Rn01_00046575 predicted 1156
8 SASI_Rn01_00046576 predicted 1053
9 SASI_Rn02_00270208 predicted 353
10 SASI_Rn01_00046577 predicted 814
11 SASI_Rn01_00046574 predicted 921
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025547 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00115767 predicted 376
2 SASI_Mm02_00328489 predicted 728
3 SASI_Mm01_00115769 predicted 711
4 SASI_Mm01_00115770 predicted 440
5 SASI_Mm02_00328490 predicted 204
6 SASI_Mm01_00115771 predicted 361
7 SASI_Mm01_00115772 predicted 531
8 SASI_Mm02_00328491 predicted 874
9 SASI_Mm01_00115773 predicted 337
10 SASI_Mm02_00328492 predicted 489
11 SASI_Mm01_00115765 predicted 1179
12 SASI_Mm01_00115766 predicted 1181
13 SASI_Mm01_00115768 predicted 1229
14 SASI_Mm01_00115774 predicted 1074
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025547
MTERFD1 MISSION shRNA Bacterial Glycerol Stock
MTERF domain containing 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183081    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025547.1-934s1c1
Sequence:CCGGCAGAAAGAACTTGAACTGAATCTCGAGATTCAGTTCAAGTTCTTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182993    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025547.1-1295s1c1
Sequence:CCGGCTTTGGACAAGTTCGTATCTTCTCGAGAAGATACGAACTTGTCCAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025547.3-986s21c1
Sequence:CCGGTCGCCTTCCAAGGCTACTAACCTCGAGGTTAGTAGCCTTGGAAGGCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025547.3-747s21c1
Sequence:CCGGGATAACCAGCTGGGACCATTTCTCGAGAAATGGTCCCAGCTGGTTATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215884    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025547.3-810s1c1
Sequence:CCGGCTTAAGACCAGAGTAGCTTATCTCGAGATAAGCTACTCTGGTCTTAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216499    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025547.3-704s1c1
Sequence:CCGGCATTAAGCAAATACTGCTATTCTCGAGAATAGCAGTATTTGCTTAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217115    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025547.3-185s1c1
Sequence:CCGGCAGACGGTTCAACTCAGTTAACTCGAGTTAACTGAGTTGAACCGTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025547.3-1177s21c1
Sequence:CCGGACCACATCATCGTCAAGTTTCCTCGAGGAAACTTGACGATGATGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025547.3-364s21c1
Sequence:CCGGTCCATTCTGCCAGCACAAATACTCGAGTATTTGTGCTGGCAGAATGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025547
MTERFD1 MISSION shRNA shRNA Plasmid DNA
MTERF domain containing 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183081    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025547.1-934s1c1
Sequence:CCGGCAGAAAGAACTTGAACTGAATCTCGAGATTCAGTTCAAGTTCTTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182993    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025547.1-1295s1c1
Sequence:CCGGCTTTGGACAAGTTCGTATCTTCTCGAGAAGATACGAACTTGTCCAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025547.3-986s21c1
Sequence:CCGGTCGCCTTCCAAGGCTACTAACCTCGAGGTTAGTAGCCTTGGAAGGCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025547.3-747s21c1
Sequence:CCGGGATAACCAGCTGGGACCATTTCTCGAGAAATGGTCCCAGCTGGTTATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215884    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025547.3-810s1c1
Sequence:CCGGCTTAAGACCAGAGTAGCTTATCTCGAGATAAGCTACTCTGGTCTTAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216499    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025547.3-704s1c1
Sequence:CCGGCATTAAGCAAATACTGCTATTCTCGAGAATAGCAGTATTTGCTTAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217115    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025547.3-185s1c1
Sequence:CCGGCAGACGGTTCAACTCAGTTAACTCGAGTTAACTGAGTTGAACCGTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025547.3-1177s21c1
Sequence:CCGGACCACATCATCGTCAAGTTTCCTCGAGGAAACTTGACGATGATGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025547.3-364s21c1
Sequence:CCGGTCCATTCTGCCAGCACAAATACTCGAGTATTTGTGCTGGCAGAATGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025547
MTERFD1 MISSION shRNA Lentiviral Transduction Particles
MTERF domain containing 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183081    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025547.1-934s1c1
Sequence:CCGGCAGAAAGAACTTGAACTGAATCTCGAGATTCAGTTCAAGTTCTTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182993    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025547.1-1295s1c1
Sequence:CCGGCTTTGGACAAGTTCGTATCTTCTCGAGAAGATACGAACTTGTCCAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025547.3-986s21c1
Sequence:CCGGTCGCCTTCCAAGGCTACTAACCTCGAGGTTAGTAGCCTTGGAAGGCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025547.3-747s21c1
Sequence:CCGGGATAACCAGCTGGGACCATTTCTCGAGAAATGGTCCCAGCTGGTTATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215884    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025547.3-810s1c1
Sequence:CCGGCTTAAGACCAGAGTAGCTTATCTCGAGATAAGCTACTCTGGTCTTAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216499    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025547.3-704s1c1
Sequence:CCGGCATTAAGCAAATACTGCTATTCTCGAGAATAGCAGTATTTGCTTAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217115    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025547.3-185s1c1
Sequence:CCGGCAGACGGTTCAACTCAGTTAACTCGAGTTAACTGAGTTGAACCGTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025547.3-1177s21c1
Sequence:CCGGACCACATCATCGTCAAGTTTCCTCGAGGAAACTTGACGATGATGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025547.3-364s21c1
Sequence:CCGGTCCATTCTGCCAGCACAAATACTCGAGTATTTGTGCTGGCAGAATGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015942
VALIDATED
MTERFD1 MISSION shRNA Bacterial Glycerol Stock
MTERF domain containing 1
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000172778    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015942.3-284s1c1
Sequence:CCGGGTTCCCAGTCTACTAGCTCAACTCGAGTTGAGCTAGTAGACTGGGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_015942.3-123s21c1
Sequence:CCGGTAAGTTGAGGAGCCTCATTAACTCGAGTTAATGAGGCTCCTCAACTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_015942.3-1124s21c1
Sequence:CCGGTCAAGTTCCCACAGGTATTTACTCGAGTAAATACCTGTGGGAACTTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_015942.3-1065s21c1
Sequence:GTACCGGACTTACCGAGACGTTTGATTTCTCGAGAAATCAAACGTCTCGGTAAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_015942.3-1174s21c1
Sequence:CCGGCACTTGTTTCTTACCTATTTACTCGAGTAAATAGGTAAGAAACAAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015942.3-944s21c1
Sequence:CCGGGAAGTCTGGAACCCGTGAAAGCTCGAGCTTTCACGGGTTCCAGACTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015942
VALIDATED
MTERFD1 MISSION shRNA shRNA Plasmid DNA
MTERF domain containing 1
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000172778    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015942.3-284s1c1
Sequence:CCGGGTTCCCAGTCTACTAGCTCAACTCGAGTTGAGCTAGTAGACTGGGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_015942.3-123s21c1
Sequence:CCGGTAAGTTGAGGAGCCTCATTAACTCGAGTTAATGAGGCTCCTCAACTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_015942.3-1124s21c1
Sequence:CCGGTCAAGTTCCCACAGGTATTTACTCGAGTAAATACCTGTGGGAACTTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_015942.3-1065s21c1
Sequence:GTACCGGACTTACCGAGACGTTTGATTTCTCGAGAAATCAAACGTCTCGGTAAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_015942.3-1174s21c1
Sequence:CCGGCACTTGTTTCTTACCTATTTACTCGAGTAAATAGGTAAGAAACAAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015942.3-944s21c1
Sequence:CCGGGAAGTCTGGAACCCGTGAAAGCTCGAGCTTTCACGGGTTCCAGACTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015942
VALIDATED
MTERFD1 MISSION shRNA Lentiviral Transduction Particles
MTERF domain containing 1
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000172778    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015942.3-284s1c1
Sequence:CCGGGTTCCCAGTCTACTAGCTCAACTCGAGTTGAGCTAGTAGACTGGGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_015942.3-123s21c1
Sequence:CCGGTAAGTTGAGGAGCCTCATTAACTCGAGTTAATGAGGCTCCTCAACTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_015942.3-1124s21c1
Sequence:CCGGTCAAGTTCCCACAGGTATTTACTCGAGTAAATACCTGTGGGAACTTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_015942.3-1065s21c1
Sequence:GTACCGGACTTACCGAGACGTTTGATTTCTCGAGAAATCAAACGTCTCGGTAAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_015942.3-1174s21c1
Sequence:CCGGCACTTGTTTCTTACCTATTTACTCGAGTAAATAGGTAAGAAACAAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015942.3-944s21c1
Sequence:CCGGGAAGTCTGGAACCCGTGAAAGCTCGAGCTTTCACGGGTTCCAGACTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)