EMAIL THIS PAGE TO A FRIEND

MTERFD3

MTERF domain containing 3

61 Gene Product Result for
Synonyms: mTERF2 mTERFL
UniProtKB ID: Q49AM1, Q53HM2, Q9H4L6, Q9H7Y9
Gene ID:
Mouse(74238) MTERF domain containing 3
Rat(366856) MTERF domain containing 3
Zebrafish(557469) MTERF domain containing 3
cow(782988) MTERF domain containing 3
Horse(100068711) MTERF domain containing 3
domestic cat(101089200) MTERF domain containing 3
dog(100685274) MTERF domain containing 3
chicken(418067) MTERF domain containing 3
domestic guinea pig(100713791) MTERF domain containing 3
naked mole-rat(101721332) MTERF domain containing 3
Domestic Rabbit(100347306) MTERF domain containing 3
sheep(101117236) MTERF domain containing 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028832 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028832 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028832 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_025198 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025198 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025198 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_286264 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_286264 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_286264 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001033050 Rosetta Predictions human pricing
NM_025198 Rosetta Predictions human pricing
NM_001014265 Rosetta Predictions rat pricing
NM_028832 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033050 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00040837 predicted 796
2 SASI_Hs01_00040838 predicted 1354
3 SASI_Hs01_00040839 predicted 756
4 SASI_Hs01_00040840 predicted 579
5 SASI_Hs02_00307982 predicted 911
6 SASI_Hs01_00040842 predicted 1328
7 SASI_Hs02_00307983 predicted 1271
8 SASI_Hs01_00040843 predicted 887
9 SASI_Hs01_00040844 predicted 446
10 SASI_Hs01_00040845 predicted 1244
11 SASI_Hs01_00040841 predicted 1402
12 SASI_Hs01_00040846 predicted 1393
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025198 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00119457 predicted 781
2 SASI_Hs01_00119458 predicted 1346
3 SASI_Hs01_00119459 predicted 745
4 SASI_Hs01_00119460 predicted 570
5 SASI_Hs02_00357975 predicted 897
6 SASI_Hs01_00119462 predicted 1321
7 SASI_Hs02_00357976 predicted 1262
8 SASI_Hs01_00119463 predicted 872
9 SASI_Hs01_00119464 predicted 437
10 SASI_Hs01_00119465 predicted 1240
11 SASI_Hs01_00119461 predicted 1394
12 SASI_Hs01_00119466 predicted 1378
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014265 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00104396 predicted 744
2 SASI_Rn01_00104397 predicted 941
3 SASI_Rn02_00201833 predicted 1366
4 SASI_Rn01_00104398 predicted 913
5 SASI_Rn01_00104399 predicted 1301
6 SASI_Rn01_00104400 predicted 526
7 SASI_Rn01_00104401 predicted 1074
8 SASI_Rn01_00104402 predicted 680
9 SASI_Rn02_00201834 predicted 779
10 SASI_Rn01_00104403 predicted 1041
11 SASI_Rn01_00104404 predicted 388
12 SASI_Rn01_00104405 predicted 1290
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028832 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00174241 predicted 1176
2 SASI_Mm01_00174242 predicted 1257
3 SASI_Mm01_00174243 predicted 1117
4 SASI_Mm01_00174244 predicted 1236
5 SASI_Mm01_00174245 predicted 1079
6 SASI_Mm01_00174246 predicted 1197
7 SASI_Mm01_00174247 predicted 1138
8 SASI_Mm01_00174248 predicted 1126
9 SASI_Mm01_00174249 predicted 459
10 SASI_Mm02_00334464 predicted 737
11 SASI_Mm01_00174240 predicted 1323
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028832
MTERFD3 MISSION shRNA Bacterial Glycerol Stock
MTERF domain containing 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000284559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028832.2-1285s21c1
Sequence:CCGGAGGAGTTTGAGGCTAACTTTACTCGAGTAAAGTTAGCCTCAAACTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028832.2-512s21c1
Sequence:CCGGACGCTGTCCGGAAGCGATTATCTCGAGATAATCGCTTCCGGACAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028832.2-1253s21c1
Sequence:CCGGTGGACATCTAGCAAGTCTAAACTCGAGTTTAGACTTGCTAGATGTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028832.2-1229s21c1
Sequence:CCGGTTCTTTAGGCTACGGAATAAACTCGAGTTTATTCCGTAGCCTAAAGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028832.2-1048s21c1
Sequence:CCGGACTATGACCTACGACAGTTAGCTCGAGCTAACTGTCGTAGGTCATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028832
MTERFD3 MISSION shRNA shRNA Plasmid DNA
MTERF domain containing 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000284559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028832.2-1285s21c1
Sequence:CCGGAGGAGTTTGAGGCTAACTTTACTCGAGTAAAGTTAGCCTCAAACTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028832.2-512s21c1
Sequence:CCGGACGCTGTCCGGAAGCGATTATCTCGAGATAATCGCTTCCGGACAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028832.2-1253s21c1
Sequence:CCGGTGGACATCTAGCAAGTCTAAACTCGAGTTTAGACTTGCTAGATGTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028832.2-1229s21c1
Sequence:CCGGTTCTTTAGGCTACGGAATAAACTCGAGTTTATTCCGTAGCCTAAAGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028832.2-1048s21c1
Sequence:CCGGACTATGACCTACGACAGTTAGCTCGAGCTAACTGTCGTAGGTCATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028832
MTERFD3 MISSION shRNA Lentiviral Transduction Particles
MTERF domain containing 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000284559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028832.2-1285s21c1
Sequence:CCGGAGGAGTTTGAGGCTAACTTTACTCGAGTAAAGTTAGCCTCAAACTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028832.2-512s21c1
Sequence:CCGGACGCTGTCCGGAAGCGATTATCTCGAGATAATCGCTTCCGGACAGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028832.2-1253s21c1
Sequence:CCGGTGGACATCTAGCAAGTCTAAACTCGAGTTTAGACTTGCTAGATGTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028832.2-1229s21c1
Sequence:CCGGTTCTTTAGGCTACGGAATAAACTCGAGTTTATTCCGTAGCCTAAAGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028832.2-1048s21c1
Sequence:CCGGACTATGACCTACGACAGTTAGCTCGAGCTAACTGTCGTAGGTCATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025198
MTERFD3 MISSION shRNA Bacterial Glycerol Stock
MTERF domain containing 3
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000179719    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025198.2-1567s1c1
Sequence:CCGGGCAGTTTGTAGACACCAGTAACTCGAGTTACTGGTGTCTACAAACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025198.3-612s21c1
Sequence:CCGGGAGACTGCTGTAGCCAGTATTCTCGAGAATACTGGCTACAGCAGTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147169    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025198.2-1568s1c1
Sequence:CCGGCAGTTTGTAGACACCAGTAATCTCGAGATTACTGGTGTCTACAAACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025198.3-1242s21c1
Sequence:CCGGGAGAGAATGCAAGGATTATTGCTCGAGCAATAATCCTTGCATTCTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025198.2-776s1c1
Sequence:CCGGCAAGAGAACCAGAAGCTGAATCTCGAGATTCAGCTTCTGGTTCTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025198.2-1376s1c1
Sequence:CCGGGATGGACATCTAGCAAATCTACTCGAGTAGATTTGCTAGATGTCCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025198.2-947s1c1
Sequence:CCGGGCCAACATGAAAGTTTGGCTACTCGAGTAGCCAAACTTTCATGTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183264    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025198.2-1600s1c1
Sequence:CCGGGCTTAGCTTCTGTGTTGTATTCTCGAGAATACAACACAGAAGCTAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025198.2-435s1c1
Sequence:CCGGGCTTCACCTATACAACTGATACTCGAGTATCAGTTGTATAGGTGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025198.3-1465s21c1
Sequence:CCGGTTAACCCTGTGGCACCATTAACTCGAGTTAATGGTGCCACAGGGTTAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025198.3-719s21c1
Sequence:CCGGGGAAGAGTTAATCAAGTTAATCTCGAGATTAACTTGATTAACTCTTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025198
MTERFD3 MISSION shRNA shRNA Plasmid DNA
MTERF domain containing 3
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000179719    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025198.2-1567s1c1
Sequence:CCGGGCAGTTTGTAGACACCAGTAACTCGAGTTACTGGTGTCTACAAACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025198.3-612s21c1
Sequence:CCGGGAGACTGCTGTAGCCAGTATTCTCGAGAATACTGGCTACAGCAGTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147169    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025198.2-1568s1c1
Sequence:CCGGCAGTTTGTAGACACCAGTAATCTCGAGATTACTGGTGTCTACAAACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025198.3-1242s21c1
Sequence:CCGGGAGAGAATGCAAGGATTATTGCTCGAGCAATAATCCTTGCATTCTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025198.2-776s1c1
Sequence:CCGGCAAGAGAACCAGAAGCTGAATCTCGAGATTCAGCTTCTGGTTCTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025198.2-1376s1c1
Sequence:CCGGGATGGACATCTAGCAAATCTACTCGAGTAGATTTGCTAGATGTCCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025198.2-947s1c1
Sequence:CCGGGCCAACATGAAAGTTTGGCTACTCGAGTAGCCAAACTTTCATGTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183264    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025198.2-1600s1c1
Sequence:CCGGGCTTAGCTTCTGTGTTGTATTCTCGAGAATACAACACAGAAGCTAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025198.2-435s1c1
Sequence:CCGGGCTTCACCTATACAACTGATACTCGAGTATCAGTTGTATAGGTGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025198.3-1465s21c1
Sequence:CCGGTTAACCCTGTGGCACCATTAACTCGAGTTAATGGTGCCACAGGGTTAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025198.3-719s21c1
Sequence:CCGGGGAAGAGTTAATCAAGTTAATCTCGAGATTAACTTGATTAACTCTTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025198
MTERFD3 MISSION shRNA Lentiviral Transduction Particles
MTERF domain containing 3
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000179719    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025198.2-1567s1c1
Sequence:CCGGGCAGTTTGTAGACACCAGTAACTCGAGTTACTGGTGTCTACAAACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025198.3-612s21c1
Sequence:CCGGGAGACTGCTGTAGCCAGTATTCTCGAGAATACTGGCTACAGCAGTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147169    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025198.2-1568s1c1
Sequence:CCGGCAGTTTGTAGACACCAGTAATCTCGAGATTACTGGTGTCTACAAACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025198.3-1242s21c1
Sequence:CCGGGAGAGAATGCAAGGATTATTGCTCGAGCAATAATCCTTGCATTCTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025198.2-776s1c1
Sequence:CCGGCAAGAGAACCAGAAGCTGAATCTCGAGATTCAGCTTCTGGTTCTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025198.2-1376s1c1
Sequence:CCGGGATGGACATCTAGCAAATCTACTCGAGTAGATTTGCTAGATGTCCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025198.2-947s1c1
Sequence:CCGGGCCAACATGAAAGTTTGGCTACTCGAGTAGCCAAACTTTCATGTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183264    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025198.2-1600s1c1
Sequence:CCGGGCTTAGCTTCTGTGTTGTATTCTCGAGAATACAACACAGAAGCTAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025198.2-435s1c1
Sequence:CCGGGCTTCACCTATACAACTGATACTCGAGTATCAGTTGTATAGGTGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025198.3-1465s21c1
Sequence:CCGGTTAACCCTGTGGCACCATTAACTCGAGTTAATGGTGCCACAGGGTTAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025198.3-719s21c1
Sequence:CCGGGGAAGAGTTAATCAAGTTAATCTCGAGATTAACTTGATTAACTCTTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_286264
VALIDATED
MTERFD3 MISSION shRNA Bacterial Glycerol Stock
MTERF domain containing 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000120282    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_286264.2-1411s1c1
Sequence:CCGGGACTTAAGCAATTCAGCTTATCTCGAGATAAGCTGAATTGCTTAAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_286264.2-918s1c1
Sequence:CCGGCTGTAGGTGAAACGCTGAAATCTCGAGATTTCAGCGTTTCACCTACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_286264.2-1218s1c1
Sequence:CCGGCGCCACAGATAATTCAATATACTCGAGTATATTGAATTATCTGTGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_286264.2-1343s1c1
Sequence:CCGGGCCAAACAAGGAAGGCCATTACTCGAGTAATGGCCTTCCTTGTTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_286264.2-620s1c1
Sequence:CCGGGCAGAGTTAGTGCAGTTAATACTCGAGTATTAACTGCACTAACTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_286264
VALIDATED
MTERFD3 MISSION shRNA shRNA Plasmid DNA
MTERF domain containing 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000120282    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_286264.2-1411s1c1
Sequence:CCGGGACTTAAGCAATTCAGCTTATCTCGAGATAAGCTGAATTGCTTAAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_286264.2-918s1c1
Sequence:CCGGCTGTAGGTGAAACGCTGAAATCTCGAGATTTCAGCGTTTCACCTACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_286264.2-1218s1c1
Sequence:CCGGCGCCACAGATAATTCAATATACTCGAGTATATTGAATTATCTGTGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_286264.2-1343s1c1
Sequence:CCGGGCCAAACAAGGAAGGCCATTACTCGAGTAATGGCCTTCCTTGTTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_286264.2-620s1c1
Sequence:CCGGGCAGAGTTAGTGCAGTTAATACTCGAGTATTAACTGCACTAACTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_286264
VALIDATED
MTERFD3 MISSION shRNA Lentiviral Transduction Particles
MTERF domain containing 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000120282    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_286264.2-1411s1c1
Sequence:CCGGGACTTAAGCAATTCAGCTTATCTCGAGATAAGCTGAATTGCTTAAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_286264.2-918s1c1
Sequence:CCGGCTGTAGGTGAAACGCTGAAATCTCGAGATTTCAGCGTTTCACCTACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_286264.2-1218s1c1
Sequence:CCGGCGCCACAGATAATTCAATATACTCGAGTATATTGAATTATCTGTGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_286264.2-1343s1c1
Sequence:CCGGGCCAAACAAGGAAGGCCATTACTCGAGTAATGGCCTTCCTTGTTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_286264.2-620s1c1
Sequence:CCGGGCAGAGTTAGTGCAGTTAATACTCGAGTATTAACTGCACTAACTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)