EMAIL THIS PAGE TO A FRIEND

MTF1

metal-regulatory transcription factor 1

54 Gene Product Result for
Synonyms: MTF-1 ZRF
UniProtKB ID: Q14872, B2RAK6, Q96CB1
Gene ID:
Human(4520) Summary: This gene encodes a transcription factor that induces expression of metallothioneins and other genes involved in metal homeostasis in response to heavy metals such as cadmium, zinc, copper, and silver. The protein is a nucleocytoplasmic shuttling protein that accumulates in the nucleus upon heavy metal exposure and binds to promoters containing a metal-responsive element (MRE). [provided by RefSeq, Jul 2008]
Mouse(17764) metal response element binding transcription factor 1
Rat(362591) metal-regulatory transcription factor 1
Zebrafish(195821) metal-regulatory transcription factor 1
dog(608127) metal-regulatory transcription factor 1
domestic cat(101092280) metal-regulatory transcription factor 1
cow(509960) metal-regulatory transcription factor 1
Horse(100054605) metal-regulatory transcription factor 1
chicken(428218) metal-regulatory transcription factor 1
sheep(101116516) metal-regulatory transcription factor 1
Domestic Rabbit(100352804) metal-regulatory transcription factor 1
naked mole-rat(101702901) metal-regulatory transcription factor 1
domestic guinea pig(100722211) metal-regulatory transcription factor 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005955 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005955 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005955 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008636 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008636 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008636 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005955 Rosetta Predictions human pricing
NM_001108677 Rosetta Predictions rat pricing
NM_008636 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005955 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00177112 predicted 310
2 SASI_Hs01_00177113 predicted 1169
3 SASI_Hs01_00177114 predicted 1113
4 SASI_Hs01_00177115 predicted 1845
5 SASI_Hs01_00177116 predicted 1898
6 SASI_Hs02_00340616 predicted 1007
7 SASI_Hs02_00340617 predicted 1237
8 SASI_Hs01_00177118 predicted 540
9 SASI_Hs01_00177119 predicted 1283
10 SASI_Hs02_00340618 predicted 1074
11 SASI_Hs01_00177110 predicted 1315
12 SASI_Hs01_00177111 predicted 1188
13 SASI_Hs01_00177117 predicted 2193
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108677 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00240985 predicted 1229
2 SASI_Rn02_00240986 predicted 382
3 SASI_Rn02_00240987 predicted 1360
4 SASI_Rn02_00240988 predicted 811
5 SASI_Rn02_00240989 predicted 876
6 SASI_Rn02_00240990 predicted 1910
7 SASI_Rn02_00240991 predicted 1056
8 SASI_Rn02_00240992 predicted 1107
9 SASI_Rn02_00240993 predicted 527
10 SASI_Rn02_00240994 predicted 1747
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008636 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00070968 predicted 1244
2 SASI_Mm01_00070969 predicted 392
3 SASI_Mm02_00314356 predicted 1369
4 SASI_Mm02_00314357 predicted 1066
5 SASI_Mm01_00070972 predicted 817
6 SASI_Mm02_00314358 predicted 1569
7 SASI_Mm01_00070973 predicted 1140
8 SASI_Mm01_00070974 predicted 1115
9 SASI_Mm01_00070975 predicted 1920
10 SASI_Mm01_00070976 predicted 541
11 SASI_Mm01_00070970 predicted 1117
12 SASI_Mm01_00070971 predicted 1048
13 SASI_Mm01_00070977 predicted 1741
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005955
MTF1 MISSION shRNA Bacterial Glycerol Stock
metal-regulatory transcription factor 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000417007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005955.2-435s21c1
Sequence:CCGGCTCACCAGATCAGATTCATTTCTCGAGAAATGAATCTGATCTGGTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005955.2-952s21c1
Sequence:CCGGGCAGCAAGCCACCACCTTAAACTCGAGTTTAAGGTGGTGGCTTGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005955.2-1849s21c1
Sequence:CCGGCAGAACTTACAATGGATATTACTCGAGTAATATCCATTGTAAGTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020454    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005955.1-2459s1c1
Sequence:CCGGCCTCACCTTTCAGACGTATTTCTCGAGAAATACGTCTGAAAGGTGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005955.1-1470s1c1
Sequence:CCGGGCTCTCTTACAACCTCCAGAACTCGAGTTCTGGAGGTTGTAAGAGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005955.1-1701s1c1
Sequence:CCGGGCCAACTCTGTCCTAACTAATCTCGAGATTAGTTAGGACAGAGTTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005955.1-2268s1c1
Sequence:CCGGCCGTCCAATCTGATTCCCATTCTCGAGAATGGGAATCAGATTGGACGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005955.1-415s1c1
Sequence:CCGGCCACACCCATGCCAAGAAATACTCGAGTATTTCTTGGCATGGGTGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005955
MTF1 MISSION shRNA shRNA Plasmid DNA
metal-regulatory transcription factor 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000417007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005955.2-435s21c1
Sequence:CCGGCTCACCAGATCAGATTCATTTCTCGAGAAATGAATCTGATCTGGTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005955.2-952s21c1
Sequence:CCGGGCAGCAAGCCACCACCTTAAACTCGAGTTTAAGGTGGTGGCTTGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005955.2-1849s21c1
Sequence:CCGGCAGAACTTACAATGGATATTACTCGAGTAATATCCATTGTAAGTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020454    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005955.1-2459s1c1
Sequence:CCGGCCTCACCTTTCAGACGTATTTCTCGAGAAATACGTCTGAAAGGTGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005955.1-1470s1c1
Sequence:CCGGGCTCTCTTACAACCTCCAGAACTCGAGTTCTGGAGGTTGTAAGAGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005955.1-1701s1c1
Sequence:CCGGGCCAACTCTGTCCTAACTAATCTCGAGATTAGTTAGGACAGAGTTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005955.1-2268s1c1
Sequence:CCGGCCGTCCAATCTGATTCCCATTCTCGAGAATGGGAATCAGATTGGACGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005955.1-415s1c1
Sequence:CCGGCCACACCCATGCCAAGAAATACTCGAGTATTTCTTGGCATGGGTGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005955
MTF1 MISSION shRNA Lentiviral Transduction Particles
metal-regulatory transcription factor 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000417007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005955.2-435s21c1
Sequence:CCGGCTCACCAGATCAGATTCATTTCTCGAGAAATGAATCTGATCTGGTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005955.2-952s21c1
Sequence:CCGGGCAGCAAGCCACCACCTTAAACTCGAGTTTAAGGTGGTGGCTTGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005955.2-1849s21c1
Sequence:CCGGCAGAACTTACAATGGATATTACTCGAGTAATATCCATTGTAAGTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020454    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005955.1-2459s1c1
Sequence:CCGGCCTCACCTTTCAGACGTATTTCTCGAGAAATACGTCTGAAAGGTGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005955.1-1470s1c1
Sequence:CCGGGCTCTCTTACAACCTCCAGAACTCGAGTTCTGGAGGTTGTAAGAGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005955.1-1701s1c1
Sequence:CCGGGCCAACTCTGTCCTAACTAATCTCGAGATTAGTTAGGACAGAGTTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005955.1-2268s1c1
Sequence:CCGGCCGTCCAATCTGATTCCCATTCTCGAGAATGGGAATCAGATTGGACGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005955.1-415s1c1
Sequence:CCGGCCACACCCATGCCAAGAAATACTCGAGTATTTCTTGGCATGGGTGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008636
VALIDATED
MTF1 MISSION shRNA Bacterial Glycerol Stock
metal-regulatory transcription factor 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000312777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008636.4-1854s21c1
Sequence:CCGGCAGAACTTACAGTGGATATTGCTCGAGCAATATCCACTGTAAGTTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008636.4-1764s21c1
Sequence:CCGGGCCAACTCTGTCCTAACTAATCTCGAGATTAGTTAGGACAGAGTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008636.4-1374s21c1
Sequence:CCGGGCAGGAAATTCGGCGTCTTTACTCGAGTAAAGACGCCGAATTTCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349758    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008636.4-1339s21c1
Sequence:CCGGGTGATGCAGAGTCCGTCATTGCTCGAGCAATGACGGACTCTGCATCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008636.2-1353s1c1
Sequence:CCGGGCAGGAAATTCGGCGTCTTTACTCGAGTAAAGACGCCGAATTTCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008636.2-1557s1c1
Sequence:CCGGGCTGCTAATCATCAAGAGTTTCTCGAGAAACTCTTGATGATTAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008636.2-1754s1c1
Sequence:CCGGCCTAACTAATAATCCCACCATCTCGAGATGGTGGGATTATTAGTTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086078    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008636.2-2477s1c1
Sequence:CCGGGCCATCTGAAAGCTCACCTTTCTCGAGAAAGGTGAGCTTTCAGATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008636.2-1352s1c1
Sequence:CCGGTGCAGGAAATTCGGCGTCTTTCTCGAGAAAGACGCCGAATTTCCTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312828    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008636.4-2509s21c1
Sequence:CCGGGCTCACCTTTCAGACGTATTTCTCGAGAAATACGTCTGAAAGGTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008636
VALIDATED
MTF1 MISSION shRNA shRNA Plasmid DNA
metal-regulatory transcription factor 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000312777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008636.4-1854s21c1
Sequence:CCGGCAGAACTTACAGTGGATATTGCTCGAGCAATATCCACTGTAAGTTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008636.4-1764s21c1
Sequence:CCGGGCCAACTCTGTCCTAACTAATCTCGAGATTAGTTAGGACAGAGTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008636.4-1374s21c1
Sequence:CCGGGCAGGAAATTCGGCGTCTTTACTCGAGTAAAGACGCCGAATTTCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349758    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008636.4-1339s21c1
Sequence:CCGGGTGATGCAGAGTCCGTCATTGCTCGAGCAATGACGGACTCTGCATCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008636.2-1353s1c1
Sequence:CCGGGCAGGAAATTCGGCGTCTTTACTCGAGTAAAGACGCCGAATTTCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008636.2-1557s1c1
Sequence:CCGGGCTGCTAATCATCAAGAGTTTCTCGAGAAACTCTTGATGATTAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008636.2-1754s1c1
Sequence:CCGGCCTAACTAATAATCCCACCATCTCGAGATGGTGGGATTATTAGTTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086078    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008636.2-2477s1c1
Sequence:CCGGGCCATCTGAAAGCTCACCTTTCTCGAGAAAGGTGAGCTTTCAGATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008636.2-1352s1c1
Sequence:CCGGTGCAGGAAATTCGGCGTCTTTCTCGAGAAAGACGCCGAATTTCCTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312828    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008636.4-2509s21c1
Sequence:CCGGGCTCACCTTTCAGACGTATTTCTCGAGAAATACGTCTGAAAGGTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008636
VALIDATED
MTF1 MISSION shRNA Lentiviral Transduction Particles
metal-regulatory transcription factor 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000312777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008636.4-1854s21c1
Sequence:CCGGCAGAACTTACAGTGGATATTGCTCGAGCAATATCCACTGTAAGTTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008636.4-1764s21c1
Sequence:CCGGGCCAACTCTGTCCTAACTAATCTCGAGATTAGTTAGGACAGAGTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008636.4-1374s21c1
Sequence:CCGGGCAGGAAATTCGGCGTCTTTACTCGAGTAAAGACGCCGAATTTCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349758    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008636.4-1339s21c1
Sequence:CCGGGTGATGCAGAGTCCGTCATTGCTCGAGCAATGACGGACTCTGCATCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008636.2-1353s1c1
Sequence:CCGGGCAGGAAATTCGGCGTCTTTACTCGAGTAAAGACGCCGAATTTCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008636.2-1557s1c1
Sequence:CCGGGCTGCTAATCATCAAGAGTTTCTCGAGAAACTCTTGATGATTAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008636.2-1754s1c1
Sequence:CCGGCCTAACTAATAATCCCACCATCTCGAGATGGTGGGATTATTAGTTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086078    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008636.2-2477s1c1
Sequence:CCGGGCCATCTGAAAGCTCACCTTTCTCGAGAAAGGTGAGCTTTCAGATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008636.2-1352s1c1
Sequence:CCGGTGCAGGAAATTCGGCGTCTTTCTCGAGAAAGACGCCGAATTTCCTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312828    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008636.4-2509s21c1
Sequence:CCGGGCTCACCTTTCAGACGTATTTCTCGAGAAATACGTCTGAAAGGTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)