EMAIL THIS PAGE TO A FRIEND

MTF2

metal response element binding transcription factor 2

93 Gene Product Result for
Synonyms: M96 PCL2 RP5-976O13.1 TDRD19A dJ976O13.2
UniProtKB ID: Q9Y483, A6NGQ9, A8K2Q3, B1AKT5, Q9UES9, Q9UP40
Gene ID:
Mouse(17765) metal response element binding transcription factor 2
Rat(360905) metal response element binding transcription factor 2
domestic guinea pig(100723500) metal response element binding transcription factor 2
Domestic Rabbit(100353693) metal response element binding transcription factor 2
sheep(101104870) metal response element binding transcription factor 2
Zebrafish(692292) metal response element binding transcription factor 2
cow(615211) metal response element binding transcription factor 2
Horse(100051293) metal response element binding transcription factor 2
domestic cat(101087854) metal response element binding transcription factor 2
dog(479948) metal response element binding transcription factor 2
chicken(395174) metal response element binding transcription factor 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013827 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013827 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013827 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_007358 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007358 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007358 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007358 Rosetta Predictions human pricing
XM_001056894 Rosetta Predictions rat pricing
XM_341180 Rosetta Predictions rat pricing
NM_013827 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007358 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00187991 predicted 1914
2 SASI_Hs02_00343459 predicted 855
3 SASI_Hs02_00343460 predicted 699
4 SASI_Hs02_00343461 predicted 1242
5 SASI_Hs01_00187994 predicted 792
6 SASI_Hs01_00187995 predicted 782
7 SASI_Hs01_00187996 predicted 310
8 SASI_Hs01_00187997 predicted 648
9 SASI_Hs02_00343462 predicted 1105
10 SASI_Hs01_00187998 predicted 1051
11 SASI_Hs01_00187992 predicted 1805
12 SASI_Hs01_00187993 predicted 615
13 SASI_Hs01_00187999 predicted 1878
14 SASI_Hs01_00188000 predicted 587
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001056894 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00284780 predicted 661
2 SASI_Rn02_00284781 predicted 624
3 SASI_Rn02_00284782 predicted 991
4 SASI_Rn02_00284783 predicted 674
5 SASI_Rn02_00284784 predicted 724
6 SASI_Rn02_00284785 predicted 846
7 SASI_Rn02_00284786 predicted 296
8 SASI_Rn02_00284787 predicted 1057
9 SASI_Rn02_00284788 predicted 1740
10 SASI_Rn02_00284789 predicted 513
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341180 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00392533 predicted 665
2 SASI_Rn02_00392534 predicted 624
3 SASI_Rn02_00392535 predicted 990
4 SASI_Rn02_00392536 predicted 675
5 SASI_Rn02_00392537 predicted 727
6 SASI_Rn02_00392538 predicted 843
7 SASI_Rn02_00392539 predicted 299
8 SASI_Rn02_00392540 predicted 1056
9 SASI_Rn02_00392541 predicted 1738
10 SASI_Rn02_00392542 predicted 518
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013827 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00103472 predicted 1628
2 SASI_Mm01_00103473 predicted 661
3 SASI_Mm01_00103474 predicted 760
4 SASI_Mm01_00103475 predicted 1166
5 SASI_Mm01_00103476 predicted 716
6 SASI_Mm01_00103477 predicted 978
7 SASI_Mm01_00103478 predicted 233
8 SASI_Mm01_00103479 predicted 564
9 SASI_Mm01_00103480 predicted 1087
10 SASI_Mm01_00103481 predicted 991
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013827
VALIDATED
MTF2 MISSION shRNA Bacterial Glycerol Stock
metal response element binding transcription factor 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257182    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013827.2-2688s21c1
Sequence:CCGGGGAGTATATATCCCATAATTCCTCGAGGAATTATGGGATATATACTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086133    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013827.1-1150s1c1
Sequence:CCGGGCCTGCTGCAATACCACATTTCTCGAGAAATGTGGTATTGCAGCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013827.1-986s1c1
Sequence:CCGGCGTTGGATTTACCTTGTTCTACTCGAGTAGAACAAGGTAAATCCAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013827.1-478s1c1
Sequence:CCGGCTACCGTTACAGTGGGTAGATCTCGAGATCTACCCACTGTAACGGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013827.1-751s1c1
Sequence:CCGGCCACCAAATGTGGCTTTCAAACTCGAGTTTGAAAGCCACATTTGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013827.1-187s1c1
Sequence:CCGGGCGCTTAAGAAAGGACCAAATCTCGAGATTTGGTCCTTTCTTAAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013827.2-841s21c1
Sequence:CCGGGGCCCTGGAGACTGGTATTTACTCGAGTAAATACCAGTCTCCAGGGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013827.2-1173s21c1
Sequence:CCGGGCATGTTCTGGAGGCATTAAACTCGAGTTTAATGCCTCCAGAACATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013827.2-1006s21c1
Sequence:CCGGCCGTTACAGTGGGTAGATATACTCGAGTATATCTACCCACTGTAACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013827.2-564s21c1
Sequence:CCGGTCCCAATGAAATGGTTATATGCTCGAGCATATAACCATTTCATTGGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013827
VALIDATED
MTF2 MISSION shRNA shRNA Plasmid DNA
metal response element binding transcription factor 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257182    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013827.2-2688s21c1
Sequence:CCGGGGAGTATATATCCCATAATTCCTCGAGGAATTATGGGATATATACTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086133    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013827.1-1150s1c1
Sequence:CCGGGCCTGCTGCAATACCACATTTCTCGAGAAATGTGGTATTGCAGCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013827.1-986s1c1
Sequence:CCGGCGTTGGATTTACCTTGTTCTACTCGAGTAGAACAAGGTAAATCCAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013827.1-478s1c1
Sequence:CCGGCTACCGTTACAGTGGGTAGATCTCGAGATCTACCCACTGTAACGGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013827.1-751s1c1
Sequence:CCGGCCACCAAATGTGGCTTTCAAACTCGAGTTTGAAAGCCACATTTGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013827.1-187s1c1
Sequence:CCGGGCGCTTAAGAAAGGACCAAATCTCGAGATTTGGTCCTTTCTTAAGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013827.2-841s21c1
Sequence:CCGGGGCCCTGGAGACTGGTATTTACTCGAGTAAATACCAGTCTCCAGGGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013827.2-1173s21c1
Sequence:CCGGGCATGTTCTGGAGGCATTAAACTCGAGTTTAATGCCTCCAGAACATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013827.2-1006s21c1
Sequence:CCGGCCGTTACAGTGGGTAGATATACTCGAGTATATCTACCCACTGTAACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013827.2-564s21c1
Sequence:CCGGTCCCAATGAAATGGTTATATGCTCGAGCATATAACCATTTCATTGGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013827
VALIDATED
MTF2 MISSION shRNA Lentiviral Transduction Particles
metal response element binding transcription factor 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257182    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013827.2-2688s21c1
Sequence:CCGGGGAGTATATATCCCATAATTCCTCGAGGAATTATGGGATATATACTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086133    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013827.1-1150s1c1
Sequence:CCGGGCCTGCTGCAATACCACATTTCTCGAGAAATGTGGTATTGCAGCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013827.1-986s1c1
Sequence:CCGGCGTTGGATTTACCTTGTTCTACTCGAGTAGAACAAGGTAAATCCAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013827.1-478s1c1
Sequence:CCGGCTACCGTTACAGTGGGTAGATCTCGAGATCTACCCACTGTAACGGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013827.1-751s1c1
Sequence:CCGGCCACCAAATGTGGCTTTCAAACTCGAGTTTGAAAGCCACATTTGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013827.1-187s1c1
Sequence:CCGGGCGCTTAAGAAAGGACCAAATCTCGAGATTTGGTCCTTTCTTAAGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013827.2-841s21c1
Sequence:CCGGGGCCCTGGAGACTGGTATTTACTCGAGTAAATACCAGTCTCCAGGGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013827.2-1173s21c1
Sequence:CCGGGCATGTTCTGGAGGCATTAAACTCGAGTTTAATGCCTCCAGAACATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013827.2-1006s21c1
Sequence:CCGGCCGTTACAGTGGGTAGATATACTCGAGTATATCTACCCACTGTAACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013827.2-564s21c1
Sequence:CCGGTCCCAATGAAATGGTTATATGCTCGAGCATATAACCATTTCATTGGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007358
VALIDATED
MTF2 MISSION shRNA Bacterial Glycerol Stock
metal response element binding transcription factor 2
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000107680    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007358.1-2180s1c1
Sequence:CCGGCCTGTCAATGTTATGGATATTCTCGAGAATATCCATAACATTGACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007358.1-736s1c1
Sequence:CCGGGCACTTAAGAAAGGACCAAATCTCGAGATTTGGTCCTTTCTTAAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007358.1-665s1c1
Sequence:CCGGGTGTGATTGATTCAGATGAAACTCGAGTTTCATCTGAATCAATCACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007358.1-1643s1c1
Sequence:CCGGCGTCTAGCATTTCCAGGCATTCTCGAGAATGCCTGGAAATGCTAGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007358.1-1382s1c1
Sequence:CCGGCCAAACCTATATCTGATTCAACTCGAGTTGAATCAGATATAGGTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_007358.3-637s21c1
Sequence:CCGGTCCCAATGAAATGGTTATATGCTCGAGCATATAACCATTTCATTGGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007358.3-1939s21c1
Sequence:GTACCGGGAACTCCATTACCAGTTATTTCTCGAGAAATAACTGGTAATGGAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007358.3-785s21c1
Sequence:CCGGGCACTTAAGAAAGGACCAAATCTCGAGATTTGGTCCTTTCTTAAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303893    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007358.3-2428s21c1
Sequence:CCGGCATGTAGATAGCACAAGTATTCTCGAGAATACTTGTGCTATCTACATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_007358.3-1079s21c1
Sequence:CCGGCCATTACAGTGGGTAGATATACTCGAGTATATCTACCCACTGTAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007358.3-1246s21c1
Sequence:CCGGGCATGTTCTGGAGGCATTAAACTCGAGTTTAATGCCTCCAGAACATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007358
VALIDATED
MTF2 MISSION shRNA shRNA Plasmid DNA
metal response element binding transcription factor 2
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000107680    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007358.1-2180s1c1
Sequence:CCGGCCTGTCAATGTTATGGATATTCTCGAGAATATCCATAACATTGACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007358.1-736s1c1
Sequence:CCGGGCACTTAAGAAAGGACCAAATCTCGAGATTTGGTCCTTTCTTAAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007358.1-665s1c1
Sequence:CCGGGTGTGATTGATTCAGATGAAACTCGAGTTTCATCTGAATCAATCACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007358.1-1643s1c1
Sequence:CCGGCGTCTAGCATTTCCAGGCATTCTCGAGAATGCCTGGAAATGCTAGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007358.1-1382s1c1
Sequence:CCGGCCAAACCTATATCTGATTCAACTCGAGTTGAATCAGATATAGGTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_007358.3-637s21c1
Sequence:CCGGTCCCAATGAAATGGTTATATGCTCGAGCATATAACCATTTCATTGGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007358.3-1939s21c1
Sequence:GTACCGGGAACTCCATTACCAGTTATTTCTCGAGAAATAACTGGTAATGGAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007358.3-785s21c1
Sequence:CCGGGCACTTAAGAAAGGACCAAATCTCGAGATTTGGTCCTTTCTTAAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303893    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007358.3-2428s21c1
Sequence:CCGGCATGTAGATAGCACAAGTATTCTCGAGAATACTTGTGCTATCTACATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_007358.3-1079s21c1
Sequence:CCGGCCATTACAGTGGGTAGATATACTCGAGTATATCTACCCACTGTAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007358.3-1246s21c1
Sequence:CCGGGCATGTTCTGGAGGCATTAAACTCGAGTTTAATGCCTCCAGAACATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007358
VALIDATED
MTF2 MISSION shRNA Lentiviral Transduction Particles
metal response element binding transcription factor 2
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000107680    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007358.1-2180s1c1
Sequence:CCGGCCTGTCAATGTTATGGATATTCTCGAGAATATCCATAACATTGACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007358.1-736s1c1
Sequence:CCGGGCACTTAAGAAAGGACCAAATCTCGAGATTTGGTCCTTTCTTAAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007358.1-665s1c1
Sequence:CCGGGTGTGATTGATTCAGATGAAACTCGAGTTTCATCTGAATCAATCACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007358.1-1643s1c1
Sequence:CCGGCGTCTAGCATTTCCAGGCATTCTCGAGAATGCCTGGAAATGCTAGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007358.1-1382s1c1
Sequence:CCGGCCAAACCTATATCTGATTCAACTCGAGTTGAATCAGATATAGGTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_007358.3-637s21c1
Sequence:CCGGTCCCAATGAAATGGTTATATGCTCGAGCATATAACCATTTCATTGGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007358.3-1939s21c1
Sequence:GTACCGGGAACTCCATTACCAGTTATTTCTCGAGAAATAACTGGTAATGGAGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007358.3-785s21c1
Sequence:CCGGGCACTTAAGAAAGGACCAAATCTCGAGATTTGGTCCTTTCTTAAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303893    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007358.3-2428s21c1
Sequence:CCGGCATGTAGATAGCACAAGTATTCTCGAGAATACTTGTGCTATCTACATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_007358.3-1079s21c1
Sequence:CCGGCCATTACAGTGGGTAGATATACTCGAGTATATCTACCCACTGTAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007358.3-1246s21c1
Sequence:CCGGGCATGTTCTGGAGGCATTAAACTCGAGTTTAATGCCTCCAGAACATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)