EMAIL THIS PAGE TO A FRIEND

MTFMT

mitochondrial methionyl-tRNA formyltransferase

71 Gene Product Result for
Synonyms: COXPD15 FMT1
UniProtKB ID: Q96DP5
Gene ID:
Human(123263) Summary: The protein encoded by this nuclear gene localizes to the mitochondrion, where it catalyzes the formylation of methionyl-tRNA. [provided by RefSeq, Jun 2011]
Mouse(69606) mitochondrial methionyl-tRNA formyltransferase
Rat(315763) mitochondrial methionyl-tRNA formyltransferase
Zebrafish(556680) mitochondrial methionyl-tRNA formyltransferase
cow(286855) mitochondrial methionyl-tRNA formyltransferase
domestic cat(101085804) mitochondrial methionyl-tRNA formyltransferase
dog(610763) mitochondrial methionyl-tRNA formyltransferase
chicken(415532) mitochondrial methionyl-tRNA formyltransferase
sheep(101110147) mitochondrial methionyl-tRNA formyltransferase
naked mole-rat(101696303) mitochondrial methionyl-tRNA formyltransferase
domestic guinea pig(100714806) mitochondrial methionyl-tRNA formyltransferase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_139242 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_139242 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_139242 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027134 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027134 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027134 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_139242 Rosetta Predictions human pricing
NM_001009697 Rosetta Predictions rat pricing
NM_027134 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139242 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00119875 predicted 535
2 SASI_Hs01_00119876 predicted 308
3 SASI_Hs01_00119877 predicted 563
4 SASI_Hs01_00119878 predicted 703
5 SASI_Hs01_00119880 predicted 884
6 SASI_Hs01_00119881 predicted 879
7 SASI_Hs01_00119882 predicted 964
8 SASI_Hs02_00364244 predicted 259
9 SASI_Hs01_00119884 predicted 694
10 SASI_Hs02_00364245 predicted 815
11 SASI_Hs01_00119879 predicted 927
12 SASI_Hs01_00119883 predicted 522
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009697 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00039182 predicted 843
2 SASI_Rn01_00039183 predicted 633
3 SASI_Rn01_00039184 predicted 286
4 SASI_Rn01_00039185 predicted 516
5 SASI_Rn01_00039186 predicted 945
6 SASI_Rn01_00039187 predicted 401
7 SASI_Rn01_00039188 predicted 806
8 SASI_Rn01_00039189 predicted 714
9 SASI_Rn01_00039190 predicted 1013
10 SASI_Rn02_00199757 predicted 285
11 SASI_Rn01_00039191 predicted 1100
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027134 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00189955 predicted 519
2 SASI_Mm01_00189946 predicted 513
3 SASI_Mm02_00331627 predicted 1153
4 SASI_Mm02_00331628 predicted 303
5 SASI_Mm01_00189949 predicted 993
6 SASI_Mm01_00189950 predicted 1150
7 SASI_Mm02_00331629 predicted 293
8 SASI_Mm02_00331630 predicted 284
9 SASI_Mm02_00331631 predicted 263
10 SASI_Mm02_00331632 predicted 248
11 SASI_Mm01_00189947 predicted 508
12 SASI_Mm01_00189948 predicted 1015
13 SASI_Mm01_00189951 predicted 1005
14 SASI_Mm01_00189952 predicted 1006
15 SASI_Mm01_00189953 predicted 832
16 SASI_Mm01_00189954 predicted 873
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_139242
VALIDATED
MTFMT MISSION shRNA Bacterial Glycerol Stock
mitochondrial methionyl-tRNA formyltransferase
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000447082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139242.3-659s21c1
Sequence:CCGGGGGTGCCAACATGCTCATTTCCTCGAGGAAATGAGCATGTTGGCACCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435963    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139242.3-1601s21c1
Sequence:CCGGGATGGCATTATTATAAGAAGACTCGAGTCTTCTTATAATAATGCCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139242.3-330s21c1
Sequence:CCGGCAGTCTCAGCTTCCCGTATATCTCGAGATATACGGGAAGCTGAGACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139242.3-974s21c1
Sequence:CCGGGTCACAAATACTATTGGTTTACTCGAGTAAACCAATAGTATTTGTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139242.3-416s21c1
Sequence:CCGGGAATGAGGCTCTTATTCTTAACTCGAGTTAAGAATAAGAGCCTCATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139242.3-858s21c1
Sequence:CCGGTGGATGGCGAATACCATTAAACTCGAGTTTAATGGTATTCGCCATCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433917    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139242.3-1578s21c1
Sequence:CCGGGAATTATCTGGACTTTCAAAGCTCGAGCTTTGAAAGTCCAGATAATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_139242.2-809s1c1
Sequence:CCGGCCGTGCCATTGGAAATATAATCTCGAGATTATATTTCCAATGGCACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_139242.2-1008s1c1
Sequence:CCGGCGATCAGTGATGCTCAAGAAACTCGAGTTTCTTGAGCATCACTGATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139242.2-568s1c1
Sequence:CCGGGCCCAATTCTCAAACAAGAAACTCGAGTTTCTTGTTTGAGAATTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_139242.2-927s1c1
Sequence:CCGGGCTCTTATTCCAGGATCAGTACTCGAGTACTGATCCTGGAATAAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_139242.2-429s1c1
Sequence:CCGGCCCTATGGCATATTGAATGTTCTCGAGAACATTCAATATGCCATAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_139242
VALIDATED
MTFMT MISSION shRNA shRNA Plasmid DNA
mitochondrial methionyl-tRNA formyltransferase
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000447082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139242.3-659s21c1
Sequence:CCGGGGGTGCCAACATGCTCATTTCCTCGAGGAAATGAGCATGTTGGCACCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435963    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139242.3-1601s21c1
Sequence:CCGGGATGGCATTATTATAAGAAGACTCGAGTCTTCTTATAATAATGCCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139242.3-330s21c1
Sequence:CCGGCAGTCTCAGCTTCCCGTATATCTCGAGATATACGGGAAGCTGAGACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139242.3-974s21c1
Sequence:CCGGGTCACAAATACTATTGGTTTACTCGAGTAAACCAATAGTATTTGTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139242.3-416s21c1
Sequence:CCGGGAATGAGGCTCTTATTCTTAACTCGAGTTAAGAATAAGAGCCTCATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139242.3-858s21c1
Sequence:CCGGTGGATGGCGAATACCATTAAACTCGAGTTTAATGGTATTCGCCATCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433917    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139242.3-1578s21c1
Sequence:CCGGGAATTATCTGGACTTTCAAAGCTCGAGCTTTGAAAGTCCAGATAATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_139242.2-809s1c1
Sequence:CCGGCCGTGCCATTGGAAATATAATCTCGAGATTATATTTCCAATGGCACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_139242.2-1008s1c1
Sequence:CCGGCGATCAGTGATGCTCAAGAAACTCGAGTTTCTTGAGCATCACTGATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139242.2-568s1c1
Sequence:CCGGGCCCAATTCTCAAACAAGAAACTCGAGTTTCTTGTTTGAGAATTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_139242.2-927s1c1
Sequence:CCGGGCTCTTATTCCAGGATCAGTACTCGAGTACTGATCCTGGAATAAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_139242.2-429s1c1
Sequence:CCGGCCCTATGGCATATTGAATGTTCTCGAGAACATTCAATATGCCATAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_139242
VALIDATED
MTFMT MISSION shRNA Lentiviral Transduction Particles
mitochondrial methionyl-tRNA formyltransferase
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000447082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139242.3-659s21c1
Sequence:CCGGGGGTGCCAACATGCTCATTTCCTCGAGGAAATGAGCATGTTGGCACCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435963    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139242.3-1601s21c1
Sequence:CCGGGATGGCATTATTATAAGAAGACTCGAGTCTTCTTATAATAATGCCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139242.3-330s21c1
Sequence:CCGGCAGTCTCAGCTTCCCGTATATCTCGAGATATACGGGAAGCTGAGACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139242.3-974s21c1
Sequence:CCGGGTCACAAATACTATTGGTTTACTCGAGTAAACCAATAGTATTTGTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139242.3-416s21c1
Sequence:CCGGGAATGAGGCTCTTATTCTTAACTCGAGTTAAGAATAAGAGCCTCATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139242.3-858s21c1
Sequence:CCGGTGGATGGCGAATACCATTAAACTCGAGTTTAATGGTATTCGCCATCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433917    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139242.3-1578s21c1
Sequence:CCGGGAATTATCTGGACTTTCAAAGCTCGAGCTTTGAAAGTCCAGATAATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_139242.2-809s1c1
Sequence:CCGGCCGTGCCATTGGAAATATAATCTCGAGATTATATTTCCAATGGCACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_139242.2-1008s1c1
Sequence:CCGGCGATCAGTGATGCTCAAGAAACTCGAGTTTCTTGAGCATCACTGATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139242.2-568s1c1
Sequence:CCGGGCCCAATTCTCAAACAAGAAACTCGAGTTTCTTGTTTGAGAATTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_139242.2-927s1c1
Sequence:CCGGGCTCTTATTCCAGGATCAGTACTCGAGTACTGATCCTGGAATAAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_139242.2-429s1c1
Sequence:CCGGCCCTATGGCATATTGAATGTTCTCGAGAACATTCAATATGCCATAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027134
VALIDATED
MTFMT MISSION shRNA Bacterial Glycerol Stock
mitochondrial methionyl-tRNA formyltransferase
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000215656    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027134.2-559s1c1
Sequence:CCGGGATTTGATATAGGCCCAATTCCTCGAGGAATTGGGCCTATATCAAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215985    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027134.2-1045s1c1
Sequence:CCGGCTGATTTCTACAATGGATATTCTCGAGAATATCCATTGTAGAAATCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027134.2-877s21c1
Sequence:CCGGATCTCGTAGAAGTTAACAATTCTCGAGAATTGTTAACTTCTACGAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027134.2-558s21c1
Sequence:CCGGAGATTTGATATAGGCCCAATTCTCGAGAATTGGGCCTATATCAAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027134.2-1001s21c1
Sequence:CCGGGATCGGTGTTCGGTCAGTAATCTCGAGATTACTGACCGAACACCGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027134.2-901s21c1
Sequence:CCGGTCCTTGCAGATCCGAAATTAACTCGAGTTAATTTCGGATCTGCAAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027134.2-849s21c1
Sequence:CCGGTGGATGGAGAACACCGTTAAACTCGAGTTTAACGGTGTTCTCCATCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000203259    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027134.1-530s1c1
Sequence:CCGGGCGTAACGATTATGCAAATTACTCGAGTAATTTGCATAATCGTTACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188879    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027134.1-1198s1c1
Sequence:CCGGGACAACGGACAAGGACCTATTCTCGAGAATAGGTCCTTGTCCGTTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027134.1-655s1c1
Sequence:CCGGGCCAACATGCTTATCTCAGTTCTCGAGAACTGAGATAAGCATGTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185782    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027134.1-1211s1c1
Sequence:CCGGGACCTATTACACACTTGTAATCTCGAGATTACAAGTGTGTAATAGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027134.1-527s1c2
Sequence:CCGGCTGGCGTAACGATTATGCAAACTCGAGTTTGCATAATCGTTACGCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027134.1-301s1c2
Sequence:CCGGCCTGTGAAGCAATATGCTATTCTCGAGAATAGCATATTGCTTCACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027134
VALIDATED
MTFMT MISSION shRNA shRNA Plasmid DNA
mitochondrial methionyl-tRNA formyltransferase
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000215656    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027134.2-559s1c1
Sequence:CCGGGATTTGATATAGGCCCAATTCCTCGAGGAATTGGGCCTATATCAAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215985    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027134.2-1045s1c1
Sequence:CCGGCTGATTTCTACAATGGATATTCTCGAGAATATCCATTGTAGAAATCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027134.2-877s21c1
Sequence:CCGGATCTCGTAGAAGTTAACAATTCTCGAGAATTGTTAACTTCTACGAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027134.2-558s21c1
Sequence:CCGGAGATTTGATATAGGCCCAATTCTCGAGAATTGGGCCTATATCAAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027134.2-1001s21c1
Sequence:CCGGGATCGGTGTTCGGTCAGTAATCTCGAGATTACTGACCGAACACCGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027134.2-901s21c1
Sequence:CCGGTCCTTGCAGATCCGAAATTAACTCGAGTTAATTTCGGATCTGCAAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027134.2-849s21c1
Sequence:CCGGTGGATGGAGAACACCGTTAAACTCGAGTTTAACGGTGTTCTCCATCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000203259    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027134.1-530s1c1
Sequence:CCGGGCGTAACGATTATGCAAATTACTCGAGTAATTTGCATAATCGTTACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000188879    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027134.1-1198s1c1
Sequence:CCGGGACAACGGACAAGGACCTATTCTCGAGAATAGGTCCTTGTCCGTTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000187556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027134.1-655s1c1
Sequence:CCGGGCCAACATGCTTATCTCAGTTCTCGAGAACTGAGATAAGCATGTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000185782    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027134.1-1211s1c1
Sequence:CCGGGACCTATTACACACTTGTAATCTCGAGATTACAAGTGTGTAATAGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027134.1-527s1c2
Sequence:CCGGCTGGCGTAACGATTATGCAAACTCGAGTTTGCATAATCGTTACGCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027134.1-301s1c2
Sequence:CCGGCCTGTGAAGCAATATGCTATTCTCGAGAATAGCATATTGCTTCACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027134
VALIDATED
MTFMT MISSION shRNA Lentiviral Transduction Particles
mitochondrial methionyl-tRNA formyltransferase
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000215656    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027134.2-559s1c1
Sequence:CCGGGATTTGATATAGGCCCAATTCCTCGAGGAATTGGGCCTATATCAAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215985    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027134.2-1045s1c1
Sequence:CCGGCTGATTTCTACAATGGATATTCTCGAGAATATCCATTGTAGAAATCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027134.2-877s21c1
Sequence:CCGGATCTCGTAGAAGTTAACAATTCTCGAGAATTGTTAACTTCTACGAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027134.2-558s21c1
Sequence:CCGGAGATTTGATATAGGCCCAATTCTCGAGAATTGGGCCTATATCAAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027134.2-1001s21c1
Sequence:CCGGGATCGGTGTTCGGTCAGTAATCTCGAGATTACTGACCGAACACCGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027134.2-901s21c1
Sequence:CCGGTCCTTGCAGATCCGAAATTAACTCGAGTTAATTTCGGATCTGCAAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027134.2-849s21c1
Sequence:CCGGTGGATGGAGAACACCGTTAAACTCGAGTTTAACGGTGTTCTCCATCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000203259    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027134.1-530s1c1
Sequence:CCGGGCGTAACGATTATGCAAATTACTCGAGTAATTTGCATAATCGTTACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188879    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027134.1-1198s1c1
Sequence:CCGGGACAACGGACAAGGACCTATTCTCGAGAATAGGTCCTTGTCCGTTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027134.1-655s1c1
Sequence:CCGGGCCAACATGCTTATCTCAGTTCTCGAGAACTGAGATAAGCATGTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185782    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027134.1-1211s1c1
Sequence:CCGGGACCTATTACACACTTGTAATCTCGAGATTACAAGTGTGTAATAGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027134.1-527s1c2
Sequence:CCGGCTGGCGTAACGATTATGCAAACTCGAGTTTGCATAATCGTTACGCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027134.1-301s1c2
Sequence:CCGGCCTGTGAAGCAATATGCTATTCTCGAGAATAGCATATTGCTTCACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)