EMAIL THIS PAGE TO A FRIEND

MTFP1

mitochondrial fission process 1

67 Gene Product Result for
Synonyms: MTP18
UniProtKB ID: Q9UDX5, A6NFQ5, Q9H3K1, Q9P0N6
Gene ID:
Human(51537) Summary: MTP18 is a mitochondrial protein and downstream target of the phosphatidylinositol 3-kinase (see PIK3CA, MIM 171834) signaling pathway that plays a role in cell viability and mitochondrial dynamics (Tondera et al., 2004 [PubMed 15155745]
Mouse(67900) mitochondrial fission process 1
Rat(289745) mitochondrial fission process 1
domestic guinea pig(100736065) mitochondrial fission process 1
naked mole-rat(101720158) mitochondrial fission process 1
sheep(101111663) mitochondrial fission process 1
chicken(417007) mitochondrial fission process 1
dog(486352) mitochondrial fission process 1
cow(525071) mitochondrial fission process 1
domestic cat(101092149) mitochondrial fission process 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016498 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016498 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016498 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026443 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026443 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026443 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001003704 Rosetta Predictions human pricing
NM_016498 Rosetta Predictions human pricing
NM_001006960 Rosetta Predictions rat pricing
NM_026443 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003704 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00174726 predicted 541
2 SASI_Hs01_00174727 predicted 525
3 SASI_Hs01_00174729 predicted 459
4 SASI_Hs01_00174730 predicted 205
5 SASI_Hs01_00174731 predicted 291
6 SASI_Hs01_00174732 predicted 416
7 SASI_Hs01_00174734 predicted 334
8 SASI_Hs01_00174735 predicted 600
9 SASI_Hs02_00304347 predicted 436
10 SASI_Hs02_00304348 predicted 203
11 SASI_Hs01_00174728 predicted 559
12 SASI_Hs01_00174733 predicted 905
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016498 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00126158 predicted 827
2 SASI_Hs01_00126159 predicted 832
3 SASI_Hs01_00126160 predicted 928
4 SASI_Hs01_00126161 predicted 862
5 SASI_Hs01_00126155 predicted 846
6 SASI_Hs01_00126156 predicted 780
7 SASI_Hs01_00126157 predicted 847
8 SASI_Hs01_00126162 predicted 849
9 SASI_Hs01_00126163 predicted 932
10 SASI_Hs02_00349563 predicted 893
11 SASI_Hs01_00126154 predicted 816
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001006960 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00073776 predicted 264
2 SASI_Rn01_00073778 predicted 646
3 SASI_Rn01_00073779 predicted 701
4 SASI_Rn01_00073780 predicted 407
5 SASI_Rn01_00073781 predicted 396
6 SASI_Rn01_00073782 predicted 1017
7 SASI_Rn01_00073783 predicted 921
8 SASI_Rn01_00073784 predicted 442
9 SASI_Rn01_00073785 predicted 396
10 SASI_Rn02_00198515 predicted 731
11 SASI_Rn01_00073777 predicted 931
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026443 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00197624 predicted 805
2 SASI_Mm01_00197625 predicted 777
3 SASI_Mm01_00197626 predicted 940
4 SASI_Mm01_00197627 predicted 1117
5 SASI_Mm01_00197628 predicted 429
6 SASI_Mm02_00330274 predicted 1038
7 SASI_Mm01_00197629 predicted 417
8 SASI_Mm01_00197630 predicted 726
9 SASI_Mm02_00330275 predicted 812
10 SASI_Mm01_00197631 predicted 943
11 SASI_Mm01_00197632 predicted 267
12 SASI_Mm01_00197633 predicted 739
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016498
MTFP1 MISSION shRNA Bacterial Glycerol Stock
mitochondrial fission process 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000188296    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016498.2-754s1c1
Sequence:CCGGCTGCTTCATGTCAACCTCCTACTCGAGTAGGAGGTTGACATGAAGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166828    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016498.2-712s1c1
Sequence:CCGGCCTCCTGATCATACTCTGGTACTCGAGTACCAGAGTATGATCAGGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165366    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016498.2-934s1c1
Sequence:CCGGGAATCCAAGATGCTGAGTGGACTCGAGTCCACTCAGCATCTTGGATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165182    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016498.2-385s1c1
Sequence:CCGGGCCATTGACAAAGGCAAGAAGCTCGAGCTTCTTGCCTTTGTCAATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204211    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016498.2-1111s1c1
Sequence:CCGGCATGGTGGTATGGCTGAACAACTCGAGTTGTTCAGCCATACCACCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204454    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016498.2-715s1c1
Sequence:CCGGCCTGATCATACTCTGGTACCTCTCGAGAGGTACCAGAGTATGATCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016498.3-568s21c1
Sequence:CCGGCATTGACAGGTCGGTGGATTTCTCGAGAAATCCACCGACCTGTCAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016498.3-306s21c1
Sequence:CCGGTGGCGGATGCCATTGACAAAGCTCGAGCTTTGTCAATGGCATCCGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016498.3-206s21c1
Sequence:CCGGCGATACCTGGGCTATGCCAATCTCGAGATTGGCATAGCCCAGGTATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244886    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016498.3-784s21c1
Sequence:CCGGGCTTAGAGACAAAGGCTTCAACTCGAGTTGAAGCCTTTGTCTCTAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016498.3-636s21c1
Sequence:CCGGCCAGCTCCTCCTGATCATACTCTCGAGAGTATGATCAGGAGGAGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016498
MTFP1 MISSION shRNA shRNA Plasmid DNA
mitochondrial fission process 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000188296    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016498.2-754s1c1
Sequence:CCGGCTGCTTCATGTCAACCTCCTACTCGAGTAGGAGGTTGACATGAAGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166828    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016498.2-712s1c1
Sequence:CCGGCCTCCTGATCATACTCTGGTACTCGAGTACCAGAGTATGATCAGGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165366    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016498.2-934s1c1
Sequence:CCGGGAATCCAAGATGCTGAGTGGACTCGAGTCCACTCAGCATCTTGGATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165182    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016498.2-385s1c1
Sequence:CCGGGCCATTGACAAAGGCAAGAAGCTCGAGCTTCTTGCCTTTGTCAATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000204211    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016498.2-1111s1c1
Sequence:CCGGCATGGTGGTATGGCTGAACAACTCGAGTTGTTCAGCCATACCACCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000204454    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016498.2-715s1c1
Sequence:CCGGCCTGATCATACTCTGGTACCTCTCGAGAGGTACCAGAGTATGATCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016498.3-568s21c1
Sequence:CCGGCATTGACAGGTCGGTGGATTTCTCGAGAAATCCACCGACCTGTCAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016498.3-306s21c1
Sequence:CCGGTGGCGGATGCCATTGACAAAGCTCGAGCTTTGTCAATGGCATCCGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016498.3-206s21c1
Sequence:CCGGCGATACCTGGGCTATGCCAATCTCGAGATTGGCATAGCCCAGGTATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244886    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016498.3-784s21c1
Sequence:CCGGGCTTAGAGACAAAGGCTTCAACTCGAGTTGAAGCCTTTGTCTCTAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016498.3-636s21c1
Sequence:CCGGCCAGCTCCTCCTGATCATACTCTCGAGAGTATGATCAGGAGGAGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016498
MTFP1 MISSION shRNA Lentiviral Transduction Particles
mitochondrial fission process 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000188296    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016498.2-754s1c1
Sequence:CCGGCTGCTTCATGTCAACCTCCTACTCGAGTAGGAGGTTGACATGAAGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166828    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016498.2-712s1c1
Sequence:CCGGCCTCCTGATCATACTCTGGTACTCGAGTACCAGAGTATGATCAGGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165366    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016498.2-934s1c1
Sequence:CCGGGAATCCAAGATGCTGAGTGGACTCGAGTCCACTCAGCATCTTGGATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165182    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016498.2-385s1c1
Sequence:CCGGGCCATTGACAAAGGCAAGAAGCTCGAGCTTCTTGCCTTTGTCAATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204211    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016498.2-1111s1c1
Sequence:CCGGCATGGTGGTATGGCTGAACAACTCGAGTTGTTCAGCCATACCACCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204454    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016498.2-715s1c1
Sequence:CCGGCCTGATCATACTCTGGTACCTCTCGAGAGGTACCAGAGTATGATCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016498.3-568s21c1
Sequence:CCGGCATTGACAGGTCGGTGGATTTCTCGAGAAATCCACCGACCTGTCAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016498.3-306s21c1
Sequence:CCGGTGGCGGATGCCATTGACAAAGCTCGAGCTTTGTCAATGGCATCCGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016498.3-206s21c1
Sequence:CCGGCGATACCTGGGCTATGCCAATCTCGAGATTGGCATAGCCCAGGTATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244886    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016498.3-784s21c1
Sequence:CCGGGCTTAGAGACAAAGGCTTCAACTCGAGTTGAAGCCTTTGTCTCTAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016498.3-636s21c1
Sequence:CCGGCCAGCTCCTCCTGATCATACTCTCGAGAGTATGATCAGGAGGAGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026443
MTFP1 MISSION shRNA Bacterial Glycerol Stock
mitochondrial fission process 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000114561    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026443.3-1200s1c1
Sequence:CCGGGCCAGTCTTCTGGCTATTCTACTCGAGTAGAATAGCCAGAAGACTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026443.3-306s1c1
Sequence:CCGGCCTGGCCGATGCCATAGACAACTCGAGTTGTCTATGGCATCGGCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026443.3-570s1c1
Sequence:CCGGCATCGACAGGTCAGTGGACTTCTCGAGAAGTCCACTGACCTGTCGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026443.3-470s1c1
Sequence:CCGGCTCTCTATGTCTTGGGTACTACTCGAGTAGTACCCAAGACATAGAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026443.4-265s21c1
Sequence:CCGGCTGTGGTGTGGTTGAGCTATGCTCGAGCATAGCTCAACCACACCACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337873    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026443.4-948s21c1
Sequence:CCGGGCAGAACCCTTAGAGGTTAAACTCGAGTTTAACCTCTAAGGGTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026443.4-440s21c1
Sequence:CCGGCTTCACCATCAACCGTCTGTGCTCGAGCACAGACGGTTGATGGTGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026443.4-471s21c1
Sequence:CCGGCTCTATGTCTTGGGTACTATGCTCGAGCATAGTACCCAAGACATAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026443.4-307s21c1
Sequence:CCGGTGGCCGATGCCATAGACAAAGCTCGAGCTTTGTCTATGGCATCGGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026443
MTFP1 MISSION shRNA shRNA Plasmid DNA
mitochondrial fission process 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000114561    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026443.3-1200s1c1
Sequence:CCGGGCCAGTCTTCTGGCTATTCTACTCGAGTAGAATAGCCAGAAGACTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026443.3-306s1c1
Sequence:CCGGCCTGGCCGATGCCATAGACAACTCGAGTTGTCTATGGCATCGGCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026443.3-570s1c1
Sequence:CCGGCATCGACAGGTCAGTGGACTTCTCGAGAAGTCCACTGACCTGTCGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026443.3-470s1c1
Sequence:CCGGCTCTCTATGTCTTGGGTACTACTCGAGTAGTACCCAAGACATAGAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026443.4-265s21c1
Sequence:CCGGCTGTGGTGTGGTTGAGCTATGCTCGAGCATAGCTCAACCACACCACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337873    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026443.4-948s21c1
Sequence:CCGGGCAGAACCCTTAGAGGTTAAACTCGAGTTTAACCTCTAAGGGTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026443.4-440s21c1
Sequence:CCGGCTTCACCATCAACCGTCTGTGCTCGAGCACAGACGGTTGATGGTGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026443.4-471s21c1
Sequence:CCGGCTCTATGTCTTGGGTACTATGCTCGAGCATAGTACCCAAGACATAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026443.4-307s21c1
Sequence:CCGGTGGCCGATGCCATAGACAAAGCTCGAGCTTTGTCTATGGCATCGGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026443
MTFP1 MISSION shRNA Lentiviral Transduction Particles
mitochondrial fission process 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000114561    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026443.3-1200s1c1
Sequence:CCGGGCCAGTCTTCTGGCTATTCTACTCGAGTAGAATAGCCAGAAGACTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026443.3-306s1c1
Sequence:CCGGCCTGGCCGATGCCATAGACAACTCGAGTTGTCTATGGCATCGGCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026443.3-570s1c1
Sequence:CCGGCATCGACAGGTCAGTGGACTTCTCGAGAAGTCCACTGACCTGTCGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026443.3-470s1c1
Sequence:CCGGCTCTCTATGTCTTGGGTACTACTCGAGTAGTACCCAAGACATAGAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026443.4-265s21c1
Sequence:CCGGCTGTGGTGTGGTTGAGCTATGCTCGAGCATAGCTCAACCACACCACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337873    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026443.4-948s21c1
Sequence:CCGGGCAGAACCCTTAGAGGTTAAACTCGAGTTTAACCTCTAAGGGTTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026443.4-440s21c1
Sequence:CCGGCTTCACCATCAACCGTCTGTGCTCGAGCACAGACGGTTGATGGTGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026443.4-471s21c1
Sequence:CCGGCTCTATGTCTTGGGTACTATGCTCGAGCATAGTACCCAAGACATAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026443.4-307s21c1
Sequence:CCGGTGGCCGATGCCATAGACAAAGCTCGAGCTTTGTCTATGGCATCGGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)