EMAIL THIS PAGE TO A FRIEND

MTFR1

mitochondrial fission regulator 1

76 Gene Product Result for
Synonyms: CHPPR FAM54A2
UniProtKB ID: Q15390, E7EP84, Q6IB94, Q7Z669, Q86XH5, Q8IVD7
Gene ID:
Human(9650) Summary: This gene encodes a mitochondrial protein that is characterized by a poly-proline rich region. A chicken homolog of this protein promotes mitochondrial fission and the mouse homolog protects cells from oxidative stress. A related pseudogene of this gene is found on chromosome X. [provided by RefSeq, Mar 2009]
Mouse(67472) mitochondrial fission regulator 1
Rat(311403) mitochondrial fission regulator 1
Zebrafish(494035) mitochondrial fission regulator 1
cow(535449) mitochondrial fission regulator 1
domestic cat(101090167) mitochondrial fission regulator 1
dog(477898) mitochondrial fission regulator 1
chicken(395222) mitochondrial fission regulator 1
sheep(101120170) mitochondrial fission regulator 1
naked mole-rat(101720034) mitochondrial fission regulator 1
domestic guinea pig(100720586) mitochondrial fission regulator 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014637 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014637 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014637 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026182 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026182 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026182 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014637 Rosetta Predictions human pricing
NM_001100977 Rosetta Predictions rat pricing
NM_026182 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014637 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00115899 predicted 277
2 SASI_Hs01_00115900 predicted 467
3 SASI_Hs02_00345947 predicted 1045
4 SASI_Hs01_00115902 predicted 645
5 SASI_Hs02_00345948 predicted 785
6 SASI_Hs01_00115903 predicted 285
7 SASI_Hs01_00115904 predicted 1157
8 SASI_Hs01_00115905 predicted 543
9 SASI_Hs01_00115906 predicted 243
10 SASI_Hs02_00345949 predicted 466
11 SASI_Hs01_00115901 predicted 1207
12 SASI_Hs01_00115907 predicted 267
13 SASI_Hs01_00115908 predicted 362
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100977 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00210912 predicted 310
2 SASI_Rn02_00210913 predicted 325
3 SASI_Rn02_00210914 predicted 809
4 SASI_Rn02_00210915 predicted 307
5 SASI_Rn02_00210916 predicted 837
6 SASI_Rn02_00210917 predicted 280
7 SASI_Rn02_00210918 predicted 807
8 SASI_Rn02_00210919 predicted 275
9 SASI_Rn02_00210920 predicted 294
10 SASI_Rn02_00210921 predicted 265
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026182 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00139929 predicted 1035
2 SASI_Mm01_00139930 predicted 198
3 SASI_Mm01_00139931 predicted 1165
4 SASI_Mm01_00139932 predicted 1095
5 SASI_Mm01_00139933 predicted 1043
6 SASI_Mm01_00139934 predicted 1113
7 SASI_Mm02_00329820 predicted 581
8 SASI_Mm01_00139935 predicted 406
9 SASI_Mm01_00139936 predicted 241
10 SASI_Mm01_00139937 predicted 1186
11 SASI_Mm01_00139938 predicted 396
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014637
VALIDATED
MTFR1 MISSION shRNA Bacterial Glycerol Stock
mitochondrial fission regulator 1
Human
17 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000343176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014637.3-1059s21c1
Sequence:CCGGGCTTATCGGTATCGAAGTGATCTCGAGATCACTTCGATACCGATAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343116    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014637.3-2172s21c1
Sequence:CCGGGCAACATAAACCATAGGTGTTCTCGAGAACACCTATGGTTTATGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343177    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014637.3-1636s21c1
Sequence:CCGGGCACTGTTATCTTCGTTTGTTCTCGAGAACAAACGAAGATAACAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014637.3-472s21c1
Sequence:CCGGGAGAGTGTTCAGCAAGACTAACTCGAGTTAGTCTTGCTGAACACTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014637.2-732s1c1
Sequence:CCGGCCAAAGTACATCTGCTGTTGACTCGAGTCAACAGCAGATGTACTTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121968    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014637.2-1843s1c1
Sequence:CCGGCCAGTAGTGATGAATCAAATTCTCGAGAATTTGATTCATCACTACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_014637.2-973s1c1
Sequence:CCGGGCTTATCGGTATCGAAGTGATCTCGAGATCACTTCGATACCGATAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139921    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014637.2-1755s1c1
Sequence:CCGGGCTTCCCATTGAAGGGAAGTTCTCGAGAACTTCCCTTCAATGGGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139067    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014637.2-979s1c1
Sequence:CCGGCGGTATCGAAGTGATAGCCAACTCGAGTTGGCTATCACTTCGATACCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_014637.2-550s1c1
Sequence:CCGGCAGAAGATTTGCGCTCTCGAACTCGAGTTCGAGAGCGCAAATCTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014637.2-386s1c1
Sequence:CCGGGAGAGTGTTCAGCAAGACTAACTCGAGTTAGTCTTGCTGAACACTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145407    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014637.2-991s1c1
Sequence:CCGGGATAGCCAAGATGAAGTTGAACTCGAGTTCAACTTCATCTTGGCTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144704    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014637.2-2086s1c1
Sequence:CCGGGCAACATAAACCATAGGTGTTCTCGAGAACACCTATGGTTTATGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144457    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_014637.2-1907s1c1
Sequence:CCGGCCATCTTGTTTCCTTTCAGTTCTCGAGAACTGAAAGGAAACAAGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_014637.2-283s1c1
Sequence:CCGGCAGTTTCAGATTAACAGCCATCTCGAGATGGCTGTTAATCTGAAACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144655    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_014637.2-1550s1c1
Sequence:CCGGGCACTGTTATCTTCGTTTGTTCTCGAGAACAAACGAAGATAACAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145051    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014637.2-733s1c1
Sequence:CCGGCAAAGTACATCTGCTGTTGATCTCGAGATCAACAGCAGATGTACTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014637
VALIDATED
MTFR1 MISSION shRNA shRNA Plasmid DNA
mitochondrial fission regulator 1
Human
17 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000343176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014637.3-1059s21c1
Sequence:CCGGGCTTATCGGTATCGAAGTGATCTCGAGATCACTTCGATACCGATAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343116    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014637.3-2172s21c1
Sequence:CCGGGCAACATAAACCATAGGTGTTCTCGAGAACACCTATGGTTTATGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343177    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014637.3-1636s21c1
Sequence:CCGGGCACTGTTATCTTCGTTTGTTCTCGAGAACAAACGAAGATAACAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014637.3-472s21c1
Sequence:CCGGGAGAGTGTTCAGCAAGACTAACTCGAGTTAGTCTTGCTGAACACTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014637.2-732s1c1
Sequence:CCGGCCAAAGTACATCTGCTGTTGACTCGAGTCAACAGCAGATGTACTTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121968    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014637.2-1843s1c1
Sequence:CCGGCCAGTAGTGATGAATCAAATTCTCGAGAATTTGATTCATCACTACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_014637.2-973s1c1
Sequence:CCGGGCTTATCGGTATCGAAGTGATCTCGAGATCACTTCGATACCGATAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139921    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014637.2-1755s1c1
Sequence:CCGGGCTTCCCATTGAAGGGAAGTTCTCGAGAACTTCCCTTCAATGGGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139067    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014637.2-979s1c1
Sequence:CCGGCGGTATCGAAGTGATAGCCAACTCGAGTTGGCTATCACTTCGATACCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_014637.2-550s1c1
Sequence:CCGGCAGAAGATTTGCGCTCTCGAACTCGAGTTCGAGAGCGCAAATCTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014637.2-386s1c1
Sequence:CCGGGAGAGTGTTCAGCAAGACTAACTCGAGTTAGTCTTGCTGAACACTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145407    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014637.2-991s1c1
Sequence:CCGGGATAGCCAAGATGAAGTTGAACTCGAGTTCAACTTCATCTTGGCTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144704    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014637.2-2086s1c1
Sequence:CCGGGCAACATAAACCATAGGTGTTCTCGAGAACACCTATGGTTTATGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144457    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_014637.2-1907s1c1
Sequence:CCGGCCATCTTGTTTCCTTTCAGTTCTCGAGAACTGAAAGGAAACAAGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_014637.2-283s1c1
Sequence:CCGGCAGTTTCAGATTAACAGCCATCTCGAGATGGCTGTTAATCTGAAACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144655    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_014637.2-1550s1c1
Sequence:CCGGGCACTGTTATCTTCGTTTGTTCTCGAGAACAAACGAAGATAACAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145051    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014637.2-733s1c1
Sequence:CCGGCAAAGTACATCTGCTGTTGATCTCGAGATCAACAGCAGATGTACTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014637
VALIDATED
MTFR1 MISSION shRNA Lentiviral Transduction Particles
mitochondrial fission regulator 1
Human
17 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000343176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014637.3-1059s21c1
Sequence:CCGGGCTTATCGGTATCGAAGTGATCTCGAGATCACTTCGATACCGATAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343116    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014637.3-2172s21c1
Sequence:CCGGGCAACATAAACCATAGGTGTTCTCGAGAACACCTATGGTTTATGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343177    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014637.3-1636s21c1
Sequence:CCGGGCACTGTTATCTTCGTTTGTTCTCGAGAACAAACGAAGATAACAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014637.3-472s21c1
Sequence:CCGGGAGAGTGTTCAGCAAGACTAACTCGAGTTAGTCTTGCTGAACACTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014637.2-732s1c1
Sequence:CCGGCCAAAGTACATCTGCTGTTGACTCGAGTCAACAGCAGATGTACTTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121968    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014637.2-1843s1c1
Sequence:CCGGCCAGTAGTGATGAATCAAATTCTCGAGAATTTGATTCATCACTACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_014637.2-973s1c1
Sequence:CCGGGCTTATCGGTATCGAAGTGATCTCGAGATCACTTCGATACCGATAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139921    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014637.2-1755s1c1
Sequence:CCGGGCTTCCCATTGAAGGGAAGTTCTCGAGAACTTCCCTTCAATGGGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139067    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014637.2-979s1c1
Sequence:CCGGCGGTATCGAAGTGATAGCCAACTCGAGTTGGCTATCACTTCGATACCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_014637.2-550s1c1
Sequence:CCGGCAGAAGATTTGCGCTCTCGAACTCGAGTTCGAGAGCGCAAATCTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014637.2-386s1c1
Sequence:CCGGGAGAGTGTTCAGCAAGACTAACTCGAGTTAGTCTTGCTGAACACTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145407    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014637.2-991s1c1
Sequence:CCGGGATAGCCAAGATGAAGTTGAACTCGAGTTCAACTTCATCTTGGCTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144704    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014637.2-2086s1c1
Sequence:CCGGGCAACATAAACCATAGGTGTTCTCGAGAACACCTATGGTTTATGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144457    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_014637.2-1907s1c1
Sequence:CCGGCCATCTTGTTTCCTTTCAGTTCTCGAGAACTGAAAGGAAACAAGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_014637.2-283s1c1
Sequence:CCGGCAGTTTCAGATTAACAGCCATCTCGAGATGGCTGTTAATCTGAAACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144655    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_014637.2-1550s1c1
Sequence:CCGGGCACTGTTATCTTCGTTTGTTCTCGAGAACAAACGAAGATAACAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145051    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014637.2-733s1c1
Sequence:CCGGCAAAGTACATCTGCTGTTGATCTCGAGATCAACAGCAGATGTACTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026182
VALIDATED
MTFR1 MISSION shRNA Bacterial Glycerol Stock
mitochondrial fission regulator 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000216270    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026182.4-263s1c1
Sequence:CCGGCAGTGTCCAAGAGTTCAATTTCTCGAGAAATTGAACTCTTGGACACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181373    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026182.3-966s1c1
Sequence:CCGGCGACACAATAGCCAAGGAGAACTCGAGTTCTCCTTGGCTATTGTGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026182.3-878s1c1
Sequence:CCGGGAGGTCAGAGAAAGATGTAAACTCGAGTTTACATCTTTCTCTGACCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026182.3-823s1c1
Sequence:CCGGCAAATATGCTTGAGATCCTTACTCGAGTAAGGATCTCAAGCATATTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176449    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026182.3-2330s1c1
Sequence:CCGGCGGTGTTATTAGAAAGTAGAACTCGAGTTCTACTTTCTAATAACACCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176719    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026182.3-1749s1c1
Sequence:CCGGCCCTATAAAGATGGATGATTTCTCGAGAAATCATCCATCTTTATAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026182.3-822s1c1
Sequence:CCGGCCAAATATGCTTGAGATCCTTCTCGAGAAGGATCTCAAGCATATTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198833    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026182.3-722s1c1
Sequence:CCGGCCAAAGTACGTCTGCTCTTGACTCGAGTCAAGAGCAGACGTACTTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026182
VALIDATED
MTFR1 MISSION shRNA shRNA Plasmid DNA
mitochondrial fission regulator 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000216270    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026182.4-263s1c1
Sequence:CCGGCAGTGTCCAAGAGTTCAATTTCTCGAGAAATTGAACTCTTGGACACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181373    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026182.3-966s1c1
Sequence:CCGGCGACACAATAGCCAAGGAGAACTCGAGTTCTCCTTGGCTATTGTGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026182.3-878s1c1
Sequence:CCGGGAGGTCAGAGAAAGATGTAAACTCGAGTTTACATCTTTCTCTGACCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026182.3-823s1c1
Sequence:CCGGCAAATATGCTTGAGATCCTTACTCGAGTAAGGATCTCAAGCATATTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176449    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026182.3-2330s1c1
Sequence:CCGGCGGTGTTATTAGAAAGTAGAACTCGAGTTCTACTTTCTAATAACACCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176719    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026182.3-1749s1c1
Sequence:CCGGCCCTATAAAGATGGATGATTTCTCGAGAAATCATCCATCTTTATAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026182.3-822s1c1
Sequence:CCGGCCAAATATGCTTGAGATCCTTCTCGAGAAGGATCTCAAGCATATTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198833    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026182.3-722s1c1
Sequence:CCGGCCAAAGTACGTCTGCTCTTGACTCGAGTCAAGAGCAGACGTACTTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026182
VALIDATED
MTFR1 MISSION shRNA Lentiviral Transduction Particles
mitochondrial fission regulator 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000216270    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026182.4-263s1c1
Sequence:CCGGCAGTGTCCAAGAGTTCAATTTCTCGAGAAATTGAACTCTTGGACACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181373    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026182.3-966s1c1
Sequence:CCGGCGACACAATAGCCAAGGAGAACTCGAGTTCTCCTTGGCTATTGTGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026182.3-878s1c1
Sequence:CCGGGAGGTCAGAGAAAGATGTAAACTCGAGTTTACATCTTTCTCTGACCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026182.3-823s1c1
Sequence:CCGGCAAATATGCTTGAGATCCTTACTCGAGTAAGGATCTCAAGCATATTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176449    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026182.3-2330s1c1
Sequence:CCGGCGGTGTTATTAGAAAGTAGAACTCGAGTTCTACTTTCTAATAACACCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176719    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026182.3-1749s1c1
Sequence:CCGGCCCTATAAAGATGGATGATTTCTCGAGAAATCATCCATCTTTATAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026182.3-822s1c1
Sequence:CCGGCCAAATATGCTTGAGATCCTTCTCGAGAAGGATCTCAAGCATATTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198833    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026182.3-722s1c1
Sequence:CCGGCCAAAGTACGTCTGCTCTTGACTCGAGTCAAGAGCAGACGTACTTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)