EMAIL THIS PAGE TO A FRIEND

MTFR1L

mitochondrial fission regulator 1-like

179 Gene Product Result for
Synonyms: FAM54B MST116 MSTP116
Gene ID:
Mouse(76824) mitochondrial fission regulator 1-like
Rat(298549) mitochondrial fission regulator 1-like
domestic guinea pig(100717099) mitochondrial fission regulator 1-like
naked mole-rat(101701375) mitochondrial fission regulator 1-like
Zebrafish(334296) mitochondrial fission regulator 1-like
cow(508852) mitochondrial fission regulator 1-like
dog(487365) mitochondrial fission regulator 1-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019557 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019557 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019557 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029759 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029759 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029759 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001099625 Rosetta Predictions human pricing
NM_001099626 Rosetta Predictions human pricing
NM_001099627 Rosetta Predictions human pricing
NM_019557 Rosetta Predictions human pricing
NM_001013935 Rosetta Predictions rat pricing
NM_029759 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099625 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00320789 predicted 975
2 SASI_Hs02_00320790 predicted 322
3 SASI_Hs02_00320791 predicted 414
4 SASI_Hs02_00320792 predicted 425
5 SASI_Hs02_00320793 predicted 398
6 SASI_Hs02_00320794 predicted 1319
7 SASI_Hs02_00320795 predicted 1308
8 SASI_Hs02_00320796 predicted 1041
9 SASI_Hs02_00320797 predicted 1289
10 SASI_Hs02_00320798 predicted 1226
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099626 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00320799 predicted 1021
2 SASI_Hs02_00320800 predicted 377
3 SASI_Hs02_00320801 predicted 465
4 SASI_Hs02_00320802 predicted 475
5 SASI_Hs02_00320803 predicted 451
6 SASI_Hs02_00320804 predicted 1369
7 SASI_Hs02_00320805 predicted 1354
8 SASI_Hs02_00320806 predicted 1093
9 SASI_Hs02_00320807 predicted 1348
10 SASI_Hs02_00320808 predicted 1279
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099627 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00320809 predicted 862
2 SASI_Hs02_00320810 predicted 331
3 SASI_Hs02_00320811 predicted 1198
4 SASI_Hs02_00320812 predicted 930
5 SASI_Hs02_00320813 predicted 1184
6 SASI_Hs02_00320814 predicted 1313
7 SASI_Hs02_00320815 predicted 1067
8 SASI_Hs02_00320816 predicted 1054
9 SASI_Hs02_00320817 predicted 1122
10 SASI_Hs02_00320818 predicted 1155
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019557 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00097849 predicted 1074
2 SASI_Hs02_00352759 predicted 429
3 SASI_Hs01_00097857 predicted 513
4 SASI_Hs02_00352760 predicted 524
5 SASI_Hs01_00097848 predicted 496
6 SASI_Hs02_00352761 predicted 1414
7 SASI_Hs02_00352762 predicted 1406
8 SASI_Hs02_00352763 predicted 1138
9 SASI_Hs02_00352764 predicted 1391
10 SASI_Hs02_00352765 predicted 1322
11 SASI_Hs01_00097850 predicted 1054
12 SASI_Hs01_00097851 predicted 1035
13 SASI_Hs01_00097852 predicted 595
14 SASI_Hs01_00097853 predicted 851
15 SASI_Hs01_00097854 predicted 691
16 SASI_Hs01_00097855 predicted 959
17 SASI_Hs01_00097856 predicted 1063
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013935 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00041875 predicted 1068
2 SASI_Rn01_00041876 predicted 394
3 SASI_Rn01_00041878 predicted 661
4 SASI_Rn01_00041879 predicted 963
5 SASI_Rn01_00041881 predicted 323
6 SASI_Rn01_00041882 predicted 928
7 SASI_Rn02_00201240 predicted 568
8 SASI_Rn02_00201241 predicted 657
9 SASI_Rn02_00201242 predicted 353
10 SASI_Rn02_00201243 predicted 757
11 SASI_Rn01_00041874 predicted 313
12 SASI_Rn01_00041877 predicted 756
13 SASI_Rn01_00041880 predicted 261
14 SASI_Rn01_00041883 predicted 602
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029759 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00335887 predicted 230
2 SASI_Mm01_00022776 predicted 1176
3 SASI_Mm01_00022783 predicted 1081
4 SASI_Mm02_00335888 predicted 1000
5 SASI_Mm01_00022778 predicted 953
6 SASI_Mm01_00022779 predicted 397
7 SASI_Mm01_00022780 predicted 302
8 SASI_Mm01_00022781 predicted 387
9 SASI_Mm01_00022782 predicted 246
10 SASI_Mm01_00022784 predicted 831
11 SASI_Mm01_00022775 predicted 1114
12 SASI_Mm01_00022777 predicted 658
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019557
VALIDATED
MTFR1L MISSION shRNA Bacterial Glycerol Stock
mitochondrial fission regulator 1-like
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_019557.3-518s1c1
Sequence:CCGGGCGGATGAAGAGGAGACATATCTCGAGATATGTCTCCTCTTCATCCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_019557.3-795s1c1
Sequence:CCGGCAGGAAGTTCAAATGTCTCTTCTCGAGAAGAGACATTTGAACTTCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_019557.3-725s1c1
Sequence:CCGGCGCAGCCAGATTGCAAAGATACTCGAGTATCTTTGCAATCTGGCTGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137896    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019557.3-755s1c1
Sequence:CCGGGATGCAGCTTCGGCTTCATTACTCGAGTAATGAAGCCGAAGCTGCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_019557.3-765s1c1
Sequence:CCGGCGGCTTCATTAACGCCAGATTCTCGAGAATCTGGCGTTAATGAAGCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_019557.3-1061s1c1
Sequence:CCGGCGAATGAAACAGAGTCAAGATCTCGAGATCTTGACTCTGTTTCATTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019557.5-946s21c1
Sequence:CCGGGTTGCAAACCAGAACACAAAGCTCGAGCTTTGTGTTCTGGTTTGCAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412380    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019557.5-1417s21c1
Sequence:CCGGGTGTAGAATGAAGTATCTTAGCTCGAGCTAAGATACTTCATTCTACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421128    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019557.5-1325s21c1
Sequence:CCGGAGAGAAGAGCTGGATTATATACTCGAGTATATAATCCAGCTCTTCTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019557.5-365s21c1
Sequence:CCGGGGCTGCTCGAAGTGTAGTAAGCTCGAGCTTACTACACTTCGAGCAGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019557.5-987s21c1
Sequence:CCGGGAGGATGACTGCGTCTCTTTGCTCGAGCAAAGAGACGCAGTCATCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427808    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019557.5-1512s21c1
Sequence:CCGGTCACTGCATTAGACCCTATAGCTCGAGCTATAGGGTCTAATGCAGTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019557
VALIDATED
MTFR1L MISSION shRNA shRNA Plasmid DNA
mitochondrial fission regulator 1-like
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_019557.3-518s1c1
Sequence:CCGGGCGGATGAAGAGGAGACATATCTCGAGATATGTCTCCTCTTCATCCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_019557.3-795s1c1
Sequence:CCGGCAGGAAGTTCAAATGTCTCTTCTCGAGAAGAGACATTTGAACTTCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_019557.3-725s1c1
Sequence:CCGGCGCAGCCAGATTGCAAAGATACTCGAGTATCTTTGCAATCTGGCTGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137896    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019557.3-755s1c1
Sequence:CCGGGATGCAGCTTCGGCTTCATTACTCGAGTAATGAAGCCGAAGCTGCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_019557.3-765s1c1
Sequence:CCGGCGGCTTCATTAACGCCAGATTCTCGAGAATCTGGCGTTAATGAAGCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_019557.3-1061s1c1
Sequence:CCGGCGAATGAAACAGAGTCAAGATCTCGAGATCTTGACTCTGTTTCATTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019557.5-946s21c1
Sequence:CCGGGTTGCAAACCAGAACACAAAGCTCGAGCTTTGTGTTCTGGTTTGCAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412380    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019557.5-1417s21c1
Sequence:CCGGGTGTAGAATGAAGTATCTTAGCTCGAGCTAAGATACTTCATTCTACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421128    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019557.5-1325s21c1
Sequence:CCGGAGAGAAGAGCTGGATTATATACTCGAGTATATAATCCAGCTCTTCTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019557.5-365s21c1
Sequence:CCGGGGCTGCTCGAAGTGTAGTAAGCTCGAGCTTACTACACTTCGAGCAGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019557.5-987s21c1
Sequence:CCGGGAGGATGACTGCGTCTCTTTGCTCGAGCAAAGAGACGCAGTCATCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427808    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019557.5-1512s21c1
Sequence:CCGGTCACTGCATTAGACCCTATAGCTCGAGCTATAGGGTCTAATGCAGTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019557
VALIDATED
MTFR1L MISSION shRNA Lentiviral Transduction Particles
mitochondrial fission regulator 1-like
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_019557.3-518s1c1
Sequence:CCGGGCGGATGAAGAGGAGACATATCTCGAGATATGTCTCCTCTTCATCCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_019557.3-795s1c1
Sequence:CCGGCAGGAAGTTCAAATGTCTCTTCTCGAGAAGAGACATTTGAACTTCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_019557.3-725s1c1
Sequence:CCGGCGCAGCCAGATTGCAAAGATACTCGAGTATCTTTGCAATCTGGCTGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137896    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019557.3-755s1c1
Sequence:CCGGGATGCAGCTTCGGCTTCATTACTCGAGTAATGAAGCCGAAGCTGCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_019557.3-765s1c1
Sequence:CCGGCGGCTTCATTAACGCCAGATTCTCGAGAATCTGGCGTTAATGAAGCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_019557.3-1061s1c1
Sequence:CCGGCGAATGAAACAGAGTCAAGATCTCGAGATCTTGACTCTGTTTCATTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019557.5-946s21c1
Sequence:CCGGGTTGCAAACCAGAACACAAAGCTCGAGCTTTGTGTTCTGGTTTGCAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412380    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019557.5-1417s21c1
Sequence:CCGGGTGTAGAATGAAGTATCTTAGCTCGAGCTAAGATACTTCATTCTACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421128    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019557.5-1325s21c1
Sequence:CCGGAGAGAAGAGCTGGATTATATACTCGAGTATATAATCCAGCTCTTCTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019557.5-365s21c1
Sequence:CCGGGGCTGCTCGAAGTGTAGTAAGCTCGAGCTTACTACACTTCGAGCAGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019557.5-987s21c1
Sequence:CCGGGAGGATGACTGCGTCTCTTTGCTCGAGCAAAGAGACGCAGTCATCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427808    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019557.5-1512s21c1
Sequence:CCGGTCACTGCATTAGACCCTATAGCTCGAGCTATAGGGTCTAATGCAGTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029759
VALIDATED
MTFR1L MISSION shRNA Bacterial Glycerol Stock
mitochondrial fission regulator 1-like
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000121000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029759.2-644s1c1
Sequence:CCGGCTCCACTCTACAACTTCCTTTCTCGAGAAAGGAAGTTGTAGAGTGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029759.2-395s1c1
Sequence:CCGGCTGATTGTCATGCAACGTAATCTCGAGATTACGTTGCATGACAATCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029759.2-185s1c1
Sequence:CCGGGTAAGAAGAATTGGGACCAATCTCGAGATTGGTCCCAATTCTTCTTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029759.2-643s1c1
Sequence:CCGGCCTCCACTCTACAACTTCCTTCTCGAGAAGGAAGTTGTAGAGTGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120997    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029759.2-1265s1c1
Sequence:CCGGGCCCTCAATGAACGACTTAATCTCGAGATTAAGTCGTTCATTGAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029759.3-605s21c1
Sequence:CCGGTCGAATGTCTCTTCGCCTTTGCTCGAGCAAAGGCGAAGAGACATTCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029759.3-255s21c1
Sequence:CCGGTCTCTGACCTGTGTTTGAAAGCTCGAGCTTTCAAACACAGGTCAGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029759.3-878s21c1
Sequence:CCGGCAAGACCTGAGCCGGAGTTTACTCGAGTAAACTCCGGCTCAGGTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366531    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029759.3-1264s21c1
Sequence:CCGGAGCCCTCAATGAACGACTTAACTCGAGTTAAGTCGTTCATTGAGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029759.3-557s21c1
Sequence:CCGGGACGCAGCTTCGGCTTCATTACTCGAGTAATGAAGCCGAAGCTGCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029759.3-358s21c1
Sequence:CCGGTACACGCCCTCTGAGACATACCTCGAGGTATGTCTCAGAGGGCGTGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375404    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029759.3-1112s21c1
Sequence:CCGGAGCTGGATTACTCGCTGTTTCCTCGAGGAAACAGCGAGTAATCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029759
VALIDATED
MTFR1L MISSION shRNA shRNA Plasmid DNA
mitochondrial fission regulator 1-like
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000121000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029759.2-644s1c1
Sequence:CCGGCTCCACTCTACAACTTCCTTTCTCGAGAAAGGAAGTTGTAGAGTGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029759.2-395s1c1
Sequence:CCGGCTGATTGTCATGCAACGTAATCTCGAGATTACGTTGCATGACAATCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029759.2-185s1c1
Sequence:CCGGGTAAGAAGAATTGGGACCAATCTCGAGATTGGTCCCAATTCTTCTTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029759.2-643s1c1
Sequence:CCGGCCTCCACTCTACAACTTCCTTCTCGAGAAGGAAGTTGTAGAGTGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120997    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029759.2-1265s1c1
Sequence:CCGGGCCCTCAATGAACGACTTAATCTCGAGATTAAGTCGTTCATTGAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029759.3-605s21c1
Sequence:CCGGTCGAATGTCTCTTCGCCTTTGCTCGAGCAAAGGCGAAGAGACATTCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029759.3-255s21c1
Sequence:CCGGTCTCTGACCTGTGTTTGAAAGCTCGAGCTTTCAAACACAGGTCAGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029759.3-878s21c1
Sequence:CCGGCAAGACCTGAGCCGGAGTTTACTCGAGTAAACTCCGGCTCAGGTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366531    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029759.3-1264s21c1
Sequence:CCGGAGCCCTCAATGAACGACTTAACTCGAGTTAAGTCGTTCATTGAGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029759.3-557s21c1
Sequence:CCGGGACGCAGCTTCGGCTTCATTACTCGAGTAATGAAGCCGAAGCTGCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029759.3-358s21c1
Sequence:CCGGTACACGCCCTCTGAGACATACCTCGAGGTATGTCTCAGAGGGCGTGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375404    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029759.3-1112s21c1
Sequence:CCGGAGCTGGATTACTCGCTGTTTCCTCGAGGAAACAGCGAGTAATCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029759
VALIDATED
MTFR1L MISSION shRNA Lentiviral Transduction Particles
mitochondrial fission regulator 1-like
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000121000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029759.2-644s1c1
Sequence:CCGGCTCCACTCTACAACTTCCTTTCTCGAGAAAGGAAGTTGTAGAGTGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029759.2-395s1c1
Sequence:CCGGCTGATTGTCATGCAACGTAATCTCGAGATTACGTTGCATGACAATCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029759.2-185s1c1
Sequence:CCGGGTAAGAAGAATTGGGACCAATCTCGAGATTGGTCCCAATTCTTCTTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029759.2-643s1c1
Sequence:CCGGCCTCCACTCTACAACTTCCTTCTCGAGAAGGAAGTTGTAGAGTGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120997    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029759.2-1265s1c1
Sequence:CCGGGCCCTCAATGAACGACTTAATCTCGAGATTAAGTCGTTCATTGAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029759.3-605s21c1
Sequence:CCGGTCGAATGTCTCTTCGCCTTTGCTCGAGCAAAGGCGAAGAGACATTCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029759.3-255s21c1
Sequence:CCGGTCTCTGACCTGTGTTTGAAAGCTCGAGCTTTCAAACACAGGTCAGAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029759.3-878s21c1
Sequence:CCGGCAAGACCTGAGCCGGAGTTTACTCGAGTAAACTCCGGCTCAGGTCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366531    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029759.3-1264s21c1
Sequence:CCGGAGCCCTCAATGAACGACTTAACTCGAGTTAAGTCGTTCATTGAGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029759.3-557s21c1
Sequence:CCGGGACGCAGCTTCGGCTTCATTACTCGAGTAATGAAGCCGAAGCTGCGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029759.3-358s21c1
Sequence:CCGGTACACGCCCTCTGAGACATACCTCGAGGTATGTCTCAGAGGGCGTGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375404    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029759.3-1112s21c1
Sequence:CCGGAGCTGGATTACTCGCTGTTTCCTCGAGGAAACAGCGAGTAATCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)