EMAIL THIS PAGE TO A FRIEND

MTG1

mitochondrial ribosome-associated GTPase 1

42 Gene Product Result for
Synonyms: GTP GTPBP7 RP11-108K14.2
UniProtKB ID: Q9BT17, Q5VWX8, Q6PIY9, Q8IYJ4, Q8NC48, Q9BVU8
Gene ID:
Mouse(212508) mitochondrial GTPase 1 homolog (S. cerevisiae)
Rat(100910751) mitochondrial ribosome-associated GTPase 1
chicken(791224) mitochondrial GTPase 1 homolog (S. cerevisiae)
domestic cat(101084062) mitochondrial GTPase 1 homolog (S. cerevisiae)
cow(509768) mitochondrial GTPase 1 homolog (S. cerevisiae)
domestic guinea pig(100725169) mitochondrial ribosome-associated GTPase 1
naked mole-rat(101726455) mitochondrial ribosome-associated GTPase 1
sheep(101118653) mitochondrial GTPase 1 homolog (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_199301 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_199301 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_199301 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_138384 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138384 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138384 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138384 Rosetta Predictions human pricing
NM_199301 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138384 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00086006 predicted 984
2 SASI_Hs01_00086007 predicted 430
3 SASI_Hs01_00086008 predicted 354
4 SASI_Hs01_00086009 predicted 576
5 SASI_Hs01_00086011 predicted 516
6 SASI_Hs01_00086012 predicted 1383
7 SASI_Hs01_00086013 predicted 1175
8 SASI_Hs02_00363520 predicted 724
9 SASI_Hs02_00363521 predicted 1089
10 SASI_Hs01_00086014 predicted 1392
11 SASI_Hs01_00086010 predicted 658
12 SASI_Hs01_00086015 predicted 985
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199301 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00139644 predicted 884
2 SASI_Mm02_00351421 predicted 909
3 SASI_Mm02_00351422 predicted 1062
4 SASI_Mm01_00139649 predicted 1002
5 SASI_Mm02_00351423 predicted 283
6 SASI_Mm01_00139652 predicted 360
7 SASI_Mm02_00351424 predicted 426
8 SASI_Mm02_00351425 predicted 939
9 SASI_Mm02_00351426 predicted 531
10 SASI_Mm02_00351427 predicted 1105
11 SASI_Mm01_00139643 predicted 580
12 SASI_Mm01_00139645 predicted 953
13 SASI_Mm01_00139646 predicted 888
14 SASI_Mm01_00139647 predicted 260
15 SASI_Mm01_00139648 predicted 754
16 SASI_Mm01_00139650 predicted 1068
17 SASI_Mm01_00139651 predicted 985
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199301
MTG1 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosome-associated GTPase 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000109805    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199301.1-1241s1c1
Sequence:CCGGCCATCTCAAGTAAGAGACAAACTCGAGTTTGTCTCTTACTTGAGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199301.1-867s1c1
Sequence:CCGGGCACAGGTAATGTCAATGTTACTCGAGTAACATTGACATTACCTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199301.1-155s1c1
Sequence:CCGGGATTGTGTTATCGAGGTTCATCTCGAGATGAACCTCGATAACACAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199301.1-430s1c1
Sequence:CCGGCCCAGAATACTGCATCATGGTCTCGAGACCATGATGCAGTATTCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199301.1-796s1c1
Sequence:CCGGCCAAATAGAGTGGGTGCTGAACTCGAGTTCAGCACCCACTCTATTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199301.2-246s21c1
Sequence:CCGGGATTGTGTTATCGAGGTTCATCTCGAGATGAACCTCGATAACACAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309338    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199301.2-1328s21c1
Sequence:CCGGCCATCTCAAGTAAGAGACAAACTCGAGTTTGTCTCTTACTTGAGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199301.2-521s21c1
Sequence:CCGGCCCAGAATACTGCATCATGGTCTCGAGACCATGATGCAGTATTCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199301.2-958s21c1
Sequence:CCGGGCACAGGTAATGTCAATGTTACTCGAGTAACATTGACATTACCTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199301
MTG1 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosome-associated GTPase 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000109805    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199301.1-1241s1c1
Sequence:CCGGCCATCTCAAGTAAGAGACAAACTCGAGTTTGTCTCTTACTTGAGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199301.1-867s1c1
Sequence:CCGGGCACAGGTAATGTCAATGTTACTCGAGTAACATTGACATTACCTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199301.1-155s1c1
Sequence:CCGGGATTGTGTTATCGAGGTTCATCTCGAGATGAACCTCGATAACACAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199301.1-430s1c1
Sequence:CCGGCCCAGAATACTGCATCATGGTCTCGAGACCATGATGCAGTATTCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199301.1-796s1c1
Sequence:CCGGCCAAATAGAGTGGGTGCTGAACTCGAGTTCAGCACCCACTCTATTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199301.2-246s21c1
Sequence:CCGGGATTGTGTTATCGAGGTTCATCTCGAGATGAACCTCGATAACACAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309338    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199301.2-1328s21c1
Sequence:CCGGCCATCTCAAGTAAGAGACAAACTCGAGTTTGTCTCTTACTTGAGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199301.2-521s21c1
Sequence:CCGGCCCAGAATACTGCATCATGGTCTCGAGACCATGATGCAGTATTCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199301.2-958s21c1
Sequence:CCGGGCACAGGTAATGTCAATGTTACTCGAGTAACATTGACATTACCTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199301
MTG1 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosome-associated GTPase 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000109805    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199301.1-1241s1c1
Sequence:CCGGCCATCTCAAGTAAGAGACAAACTCGAGTTTGTCTCTTACTTGAGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199301.1-867s1c1
Sequence:CCGGGCACAGGTAATGTCAATGTTACTCGAGTAACATTGACATTACCTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199301.1-155s1c1
Sequence:CCGGGATTGTGTTATCGAGGTTCATCTCGAGATGAACCTCGATAACACAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199301.1-430s1c1
Sequence:CCGGCCCAGAATACTGCATCATGGTCTCGAGACCATGATGCAGTATTCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199301.1-796s1c1
Sequence:CCGGCCAAATAGAGTGGGTGCTGAACTCGAGTTCAGCACCCACTCTATTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199301.2-246s21c1
Sequence:CCGGGATTGTGTTATCGAGGTTCATCTCGAGATGAACCTCGATAACACAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309338    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199301.2-1328s21c1
Sequence:CCGGCCATCTCAAGTAAGAGACAAACTCGAGTTTGTCTCTTACTTGAGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199301.2-521s21c1
Sequence:CCGGCCCAGAATACTGCATCATGGTCTCGAGACCATGATGCAGTATTCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199301.2-958s21c1
Sequence:CCGGGCACAGGTAATGTCAATGTTACTCGAGTAACATTGACATTACCTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138384
MTG1 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosome-associated GTPase 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000150239    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138384.1-452s1c1
Sequence:CCGGGAGTACTGTATCATGGTCATTCTCGAGAATGACCATGATACAGTACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146550    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138384.1-357s1c1
Sequence:CCGGCCAACTGTGTAAAGGATGAAACTCGAGTTTCATCCTTTACACAGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138384.2-532s21c1
Sequence:CCGGAGTACTGTATCATGGTCATTGCTCGAGCAATGACCATGATACAGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138384.2-356s21c1
Sequence:CCGGGATGGACTTGGCGGATCTTACCTCGAGGTAAGATCCGCCAAGTCCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138384.2-823s21c1
Sequence:CCGGTGCTGTACACCCTCAACAAACCTCGAGGTTTGTTGAGGGTGTACAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235036    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138384.2-1387s21c1
Sequence:CCGGGCTGTCTCAGAAGGAGTTAAACTCGAGTTTAACTCCTTCTGAGACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138384.2-966s21c1
Sequence:CCGGACGGGTAACGTGAACATTATTCTCGAGAATAATGTTCACGTTACCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138384
MTG1 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosome-associated GTPase 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000150239    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138384.1-452s1c1
Sequence:CCGGGAGTACTGTATCATGGTCATTCTCGAGAATGACCATGATACAGTACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146550    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138384.1-357s1c1
Sequence:CCGGCCAACTGTGTAAAGGATGAAACTCGAGTTTCATCCTTTACACAGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138384.2-532s21c1
Sequence:CCGGAGTACTGTATCATGGTCATTGCTCGAGCAATGACCATGATACAGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138384.2-356s21c1
Sequence:CCGGGATGGACTTGGCGGATCTTACCTCGAGGTAAGATCCGCCAAGTCCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138384.2-823s21c1
Sequence:CCGGTGCTGTACACCCTCAACAAACCTCGAGGTTTGTTGAGGGTGTACAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235036    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138384.2-1387s21c1
Sequence:CCGGGCTGTCTCAGAAGGAGTTAAACTCGAGTTTAACTCCTTCTGAGACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138384.2-966s21c1
Sequence:CCGGACGGGTAACGTGAACATTATTCTCGAGAATAATGTTCACGTTACCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138384
MTG1 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosome-associated GTPase 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000150239    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138384.1-452s1c1
Sequence:CCGGGAGTACTGTATCATGGTCATTCTCGAGAATGACCATGATACAGTACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146550    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138384.1-357s1c1
Sequence:CCGGCCAACTGTGTAAAGGATGAAACTCGAGTTTCATCCTTTACACAGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138384.2-532s21c1
Sequence:CCGGAGTACTGTATCATGGTCATTGCTCGAGCAATGACCATGATACAGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138384.2-356s21c1
Sequence:CCGGGATGGACTTGGCGGATCTTACCTCGAGGTAAGATCCGCCAAGTCCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138384.2-823s21c1
Sequence:CCGGTGCTGTACACCCTCAACAAACCTCGAGGTTTGTTGAGGGTGTACAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235036    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138384.2-1387s21c1
Sequence:CCGGGCTGTCTCAGAAGGAGTTAAACTCGAGTTTAACTCCTTCTGAGACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138384.2-966s21c1
Sequence:CCGGACGGGTAACGTGAACATTATTCTCGAGAATAATGTTCACGTTACCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)