EMAIL THIS PAGE TO A FRIEND

MTG2

mitochondrial ribosome-associated GTPase 2

69 Gene Product Result for
Synonyms: GTPBP5 ObgH1 dJ1005F21.2
Species: Human MTG2(26164), Mouse Mtg2(52856), naked mole-rat Mtg2(101698427), domestic guinea pig Mtg2(100713250), Zebrafish mtg2(100001905)
Gene ID:
Human(26164) Summary: Small G proteins, such as GTPBP5, act as molecular switches that play crucial roles in the regulation of fundamental cellular processes such as protein synthesis, nuclear transport, membrane trafficking, and signal transduction (Hirano et al., 2006 [PubMed 17054726]
Mouse(52856) mitochondrial ribosome associated GTPase 2
naked mole-rat(101698427) mitochondrial ribosome-associated GTPase 2
domestic guinea pig(100713250) mitochondrial ribosome-associated GTPase 2
Zebrafish(100001905) mitochondrial ribosome-associated GTPase 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_181424 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_181424 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_181424 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015666 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015666 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015666 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015666 Rosetta Predictions human pricing
NM_001083328 Rosetta Predictions mouse pricing
NM_001083329 Rosetta Predictions mouse pricing
NM_028422 Rosetta Predictions mouse pricing
NM_181424 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015666 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00348290 predicted 605
2 SASI_Hs01_00114349 predicted 1439
3 SASI_Hs01_00114350 predicted 381
4 SASI_Hs01_00114351 predicted 246
5 SASI_Hs01_00114352 predicted 987
6 SASI_Hs01_00114353 predicted 1458
7 SASI_Hs01_00114354 predicted 1398
8 SASI_Hs01_00114355 predicted 1292
9 SASI_Hs01_00114356 predicted 1474
10 SASI_Hs01_00114357 predicted 930
11 SASI_Hs01_00114358 predicted 276
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001083328 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00299651 predicted 1158
2 SASI_Mm02_00299652 predicted 555
3 SASI_Mm02_00299653 predicted 1211
4 SASI_Mm02_00299654 predicted 1115
5 SASI_Mm02_00299655 predicted 551
6 SASI_Mm02_00299656 predicted 1121
7 SASI_Mm02_00299657 predicted 541
8 SASI_Mm02_00299658 predicted 855
9 SASI_Mm02_00299659 predicted 617
10 SASI_Mm02_00299660 predicted 1297
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001083329 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00299661 predicted 1067
2 SASI_Mm02_00299662 predicted 458
3 SASI_Mm02_00299663 predicted 1118
4 SASI_Mm02_00299664 predicted 1019
5 SASI_Mm02_00299665 predicted 459
6 SASI_Mm02_00299666 predicted 1029
7 SASI_Mm02_00299667 predicted 443
8 SASI_Mm02_00299668 predicted 767
9 SASI_Mm02_00299669 predicted 525
10 SASI_Mm02_00299670 predicted 1206
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028422 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00333837 predicted 1205
2 SASI_Mm02_00333838 predicted 604
3 SASI_Mm02_00333839 predicted 1261
4 SASI_Mm02_00333840 predicted 1152
5 SASI_Mm02_00333841 predicted 599
6 SASI_Mm02_00333842 predicted 1166
7 SASI_Mm02_00333843 predicted 586
8 SASI_Mm02_00333844 predicted 905
9 SASI_Mm02_00333845 predicted 663
10 SASI_Mm02_00333846 predicted 1345
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181424 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00111551 predicted 1297
2 SASI_Mm01_00111552 predicted 690
3 SASI_Mm01_00111553 predicted 1349
4 SASI_Mm01_00111554 predicted 1252
5 SASI_Mm01_00111556 predicted 688
6 SASI_Mm01_00111558 predicted 1263
7 SASI_Mm01_00111559 predicted 683
8 SASI_Mm02_00349783 predicted 992
9 SASI_Mm02_00349784 predicted 752
10 SASI_Mm02_00349785 predicted 1432
11 SASI_Mm01_00111550 predicted 451
12 SASI_Mm01_00111555 predicted 533
13 SASI_Mm01_00111557 predicted 449
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181424
MTG2 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosome-associated GTPase 2
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000258079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181424.3-1303s21c1
Sequence:CCGGGGACTCAGGTTGATGATTTAACTCGAGTTAAATCATCAACCTGAGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181424.2-832s1c1
Sequence:CCGGCTTGGTGAAAGAAGGAGACAACTCGAGTTGTCTCCTTCTTTCACCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181424.3-1367s1c1
Sequence:CCGGCCACGTGATCATTGCAAATAACTCGAGTTATTTGCAATGATCACGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181424.3-1268s21c1
Sequence:CCGGCCTGTTTGTGGTAGATCTTACCTCGAGGTAAGATCTACCACAAACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181424.3-718s21c1
Sequence:CCGGAGTCCTTGTCCTCAGTCTTATCTCGAGATAAGACTGAGGACAAGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181424.3-1063s21c1
Sequence:CCGGCCTCTCTCCTTCGAGCCATTTCTCGAGAAATGGCTCGAAGGAGAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181424.3-1360s21c1
Sequence:CCGGAGAGGTCCCACGTGATCATTGCTCGAGCAATGATCACGTGGGACCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181424
MTG2 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosome-associated GTPase 2
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000258079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181424.3-1303s21c1
Sequence:CCGGGGACTCAGGTTGATGATTTAACTCGAGTTAAATCATCAACCTGAGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181424.2-832s1c1
Sequence:CCGGCTTGGTGAAAGAAGGAGACAACTCGAGTTGTCTCCTTCTTTCACCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181424.3-1367s1c1
Sequence:CCGGCCACGTGATCATTGCAAATAACTCGAGTTATTTGCAATGATCACGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181424.3-1268s21c1
Sequence:CCGGCCTGTTTGTGGTAGATCTTACCTCGAGGTAAGATCTACCACAAACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181424.3-718s21c1
Sequence:CCGGAGTCCTTGTCCTCAGTCTTATCTCGAGATAAGACTGAGGACAAGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181424.3-1063s21c1
Sequence:CCGGCCTCTCTCCTTCGAGCCATTTCTCGAGAAATGGCTCGAAGGAGAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181424.3-1360s21c1
Sequence:CCGGAGAGGTCCCACGTGATCATTGCTCGAGCAATGATCACGTGGGACCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181424
MTG2 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosome-associated GTPase 2
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000258079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181424.3-1303s21c1
Sequence:CCGGGGACTCAGGTTGATGATTTAACTCGAGTTAAATCATCAACCTGAGTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181424.2-832s1c1
Sequence:CCGGCTTGGTGAAAGAAGGAGACAACTCGAGTTGTCTCCTTCTTTCACCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181424.3-1367s1c1
Sequence:CCGGCCACGTGATCATTGCAAATAACTCGAGTTATTTGCAATGATCACGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181424.3-1268s21c1
Sequence:CCGGCCTGTTTGTGGTAGATCTTACCTCGAGGTAAGATCTACCACAAACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181424.3-718s21c1
Sequence:CCGGAGTCCTTGTCCTCAGTCTTATCTCGAGATAAGACTGAGGACAAGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181424.3-1063s21c1
Sequence:CCGGCCTCTCTCCTTCGAGCCATTTCTCGAGAAATGGCTCGAAGGAGAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181424.3-1360s21c1
Sequence:CCGGAGAGGTCCCACGTGATCATTGCTCGAGCAATGATCACGTGGGACCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015666
VALIDATED
MTG2 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosome-associated GTPase 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000048038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015666.2-1174s1c1
Sequence:CCGGCGTGGACTCAAGTTGACGATTCTCGAGAATCGTCAACTTGAGTCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015666.2-372s1c1
Sequence:CCGGGACCTCGCCAAGCATCAGGAACTCGAGTTCCTGATGCTTGGCGAGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430504    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015666.3-1496s21c1
Sequence:CCGGTGCTCATTTGTGCTGATTAACCTCGAGGTTAATCAGCACAAATGAGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015666.3-365s21c1
Sequence:CCGGCAACGGTGGACACGTCATTCTCTCGAGAGAATGACGTGTCCACCGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015666.2-1250s1c1
Sequence:CCGGCGTCGCAAACAAGATTGACCTCTCGAGAGGTCAATCTTGTTTGCGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015666.2-971s1c1
Sequence:CCGGCGCCGTGGCTTCCTACCCGTTCTCGAGAACGGGTAGGAAGCCACGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015666.2-747s1c1
Sequence:CCGGTGCGTGGGAGATGAGTACATTCTCGAGAATGTACTCATCTCCCACGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015666
VALIDATED
MTG2 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosome-associated GTPase 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000048038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015666.2-1174s1c1
Sequence:CCGGCGTGGACTCAAGTTGACGATTCTCGAGAATCGTCAACTTGAGTCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015666.2-372s1c1
Sequence:CCGGGACCTCGCCAAGCATCAGGAACTCGAGTTCCTGATGCTTGGCGAGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430504    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015666.3-1496s21c1
Sequence:CCGGTGCTCATTTGTGCTGATTAACCTCGAGGTTAATCAGCACAAATGAGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015666.3-365s21c1
Sequence:CCGGCAACGGTGGACACGTCATTCTCTCGAGAGAATGACGTGTCCACCGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015666.2-1250s1c1
Sequence:CCGGCGTCGCAAACAAGATTGACCTCTCGAGAGGTCAATCTTGTTTGCGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015666.2-971s1c1
Sequence:CCGGCGCCGTGGCTTCCTACCCGTTCTCGAGAACGGGTAGGAAGCCACGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015666.2-747s1c1
Sequence:CCGGTGCGTGGGAGATGAGTACATTCTCGAGAATGTACTCATCTCCCACGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015666
VALIDATED
MTG2 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosome-associated GTPase 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000048038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015666.2-1174s1c1
Sequence:CCGGCGTGGACTCAAGTTGACGATTCTCGAGAATCGTCAACTTGAGTCCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015666.2-372s1c1
Sequence:CCGGGACCTCGCCAAGCATCAGGAACTCGAGTTCCTGATGCTTGGCGAGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430504    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015666.3-1496s21c1
Sequence:CCGGTGCTCATTTGTGCTGATTAACCTCGAGGTTAATCAGCACAAATGAGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015666.3-365s21c1
Sequence:CCGGCAACGGTGGACACGTCATTCTCTCGAGAGAATGACGTGTCCACCGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015666.2-1250s1c1
Sequence:CCGGCGTCGCAAACAAGATTGACCTCTCGAGAGGTCAATCTTGTTTGCGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015666.2-971s1c1
Sequence:CCGGCGCCGTGGCTTCCTACCCGTTCTCGAGAACGGGTAGGAAGCCACGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015666.2-747s1c1
Sequence:CCGGTGCGTGGGAGATGAGTACATTCTCGAGAATGTACTCATCTCCCACGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)