EMAIL THIS PAGE TO A FRIEND

MTHFD1

methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1, methenyltetrahydrofolate cyclohydrolase, formyltetrahydrofolate synthetase

55 Gene Product Result for
Synonyms: MTHFC MTHFD
UniProtKB ID: P11586, B2R5Y2, Q86VC9, Q9BVP5
Gene ID:
Human(4522) Summary: This gene encodes a protein that possesses three distinct enzymatic activities, 5,10-methylenetetrahydrofolate dehydrogenase, 5,10-methenyltetrahydrofolate cyclohydrolase and 10-formyltetrahydrofolate synthetase. Each of these activities catalyzes one of three sequential reactions in the interconversion of 1-carbon derivatives of tetrahydrofolate, which are substrates for methionine, thymidylate, and de novo purine syntheses. The trifunctional enzymatic activities are conferred by two major domains, an aminoterminal portion containing the dehydrogenase and cyclohydrolase activities and a larger synthetase domain. [provided by RefSeq, Jul 2008]
Mouse(108156) methylenetetrahydrofolate dehydrogenase (NADP+ dependent), methenyltetrahydrofolate cyclohydrolase, formyltetrahydrofolate synthase
Rat(64300) methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1, methenyltetrahydrofolate cyclohydrolase, formyltetrahydrofolate synthetase
chicken(423508) methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1, methenyltetrahydrofolate cyclohydrolase, formyltetrahydrofolate synthetase
cow(534382) methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1, methenyltetrahydrofolate cyclohydrolase, formyltetrahydrofolate synthetase
Horse(100062154) methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1, methenyltetrahydrofolate cyclohydrolase, formyltetrahydrofolate synthetase
domestic cat(101086816) methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1, methenyltetrahydrofolate cyclohydrolase, formyltetrahydrofolate synthetase
dog(480352) methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1, methenyltetrahydrofolate cyclohydrolase, formyltetrahydrofolate synthetase
sheep(101109020) methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1, methenyltetrahydrofolate cyclohydrolase, formyltetrahydrofolate synthetase
domestic guinea pig(100734825) methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1, methenyltetrahydrofolate cyclohydrolase, formyltetrahydrofolate synthetase
naked mole-rat(101707403) methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1, methenyltetrahydrofolate cyclohydrolase, formyltetrahydrofolate synthetase
Gene Class: Dehydrogenase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2500652 Anti-MTHFD1 antibody produced in goat affinity isolated antibody, buffered aqueous solution human, rat, mouse
ELISA, western blot pricing
SAB1406147 Anti-MTHFD1 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
HPA000704 Anti-MTHFD1 antibody produced in rabbit Ab1, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human, mouse, rat
immunohistochemistry, western blot pricing
SAB2101519 Anti-MTHFD1 antibody produced in rabbit affinity isolated antibody horse, rat, rabbit, mouse, bovine, human, canine, guinea pig, zebrafish
immunohistochemistry, western blot pricing
HPA001290 Anti-MTHFD1 antibody produced in rabbit Ab2, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB2103822 Anti-MTHFD1 antibody produced in rabbit affinity isolated antibody , rabbit, guinea pig, bovine, mouse, horse, human, rat, zebrafish, pig, canine
immunohistochemistry, western blot pricing
HPA015006 Anti-MTHFD1 antibody produced in rabbit Ab3, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution rat, human, mouse
immunohistochemistry, western blot pricing
HPA050052 Anti-MTHFD1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138745 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_138745 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_138745 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005956 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005956 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005956 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005956 Rosetta Predictions human pricing
NM_022508 Rosetta Predictions rat pricing
NM_138745 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005956 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00090500 predicted 1642
2 SASI_Hs01_00090501 predicted 330
3 SASI_Hs01_00090502 predicted 1428
4 SASI_Hs01_00090503 predicted 424
5 SASI_Hs01_00090504 predicted 954
6 SASI_Hs02_00340619 predicted 992
7 SASI_Hs01_00090505 predicted 999
8 SASI_Hs01_00090506 predicted 1620
9 SASI_Hs02_00340620 predicted 2643
10 SASI_Hs01_00090507 predicted 1538
11 SASI_Hs01_00090499 predicted 313
12 SASI_Hs01_00090508 predicted 1061
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022508 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00082035 predicted 1265
2 SASI_Rn02_00263239 predicted 2901
3 SASI_Rn01_00082036 predicted 1922
4 SASI_Rn01_00082037 predicted 3004
5 SASI_Rn01_00082038 predicted 1366
6 SASI_Rn01_00082039 predicted 1709
7 SASI_Rn01_00082040 predicted 1251
8 SASI_Rn01_00082041 predicted 1844
9 SASI_Rn01_00082042 predicted 1597
10 SASI_Rn01_00082043 predicted 1672
11 SASI_Rn01_00082044 predicted 3086
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138745 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00076492 predicted 1056
2 SASI_Mm01_00076493 predicted 2695
3 SASI_Mm01_00076495 predicted 1374
4 SASI_Mm02_00339794 predicted 1465
5 SASI_Mm01_00076496 predicted 1042
6 SASI_Mm01_00076497 predicted 544
7 SASI_Mm01_00076498 predicted 277
8 SASI_Mm01_00076499 predicted 2005
9 SASI_Mm02_00339795 predicted 1642
10 SASI_Mm01_00076500 predicted 1967
11 SASI_Mm01_00076491 predicted 722
12 SASI_Mm01_00076494 predicted 2823
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138745
VALIDATED
MTHFD1 MISSION shRNA Bacterial Glycerol Stock
methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1, methenyltetrahydrofolate cyclohydrolase, formyltetrahydrofolate synthetase
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000042028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138745.1-2015s1c1
Sequence:CCGGCCAACATTGCACACGGGAATTCTCGAGAATTCCCGTGTGCAATGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138745.1-2626s1c1
Sequence:CCGGGAAGCACAGAACAAAGCAGAACTCGAGTTCTGCTTTGTTCTGTGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138745.1-296s1c1
Sequence:CCGGCCACTCACATTAAATTACCAACTCGAGTTGGTAATTTAATGTGAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138745.1-1516s1c1
Sequence:CCGGGCTCTCTTTAATCGTCTGGTACTCGAGTACCAGACGATTAAAGAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138745.1-274s1c1
Sequence:CCGGGCTGAGGAGATTGGGATCAAACTCGAGTTTGATCCCAATCTCCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138745.1-1516s21c1
Sequence:CCGGGCTCTCTTTAATCGTCTGGTACTCGAGTACCAGACGATTAAAGAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138745.1-2626s21c1
Sequence:CCGGGAAGCACAGAACAAAGCAGAACTCGAGTTCTGCTTTGTTCTGTGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138745.1-296s21c1
Sequence:CCGGCCACTCACATTAAATTACCAACTCGAGTTGGTAATTTAATGTGAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138745.1-2015s21c1
Sequence:CCGGCCAACATTGCACACGGGAATTCTCGAGAATTCCCGTGTGCAATGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138745
VALIDATED
MTHFD1 MISSION shRNA shRNA Plasmid DNA
methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1, methenyltetrahydrofolate cyclohydrolase, formyltetrahydrofolate synthetase
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000042028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138745.1-2015s1c1
Sequence:CCGGCCAACATTGCACACGGGAATTCTCGAGAATTCCCGTGTGCAATGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138745.1-2626s1c1
Sequence:CCGGGAAGCACAGAACAAAGCAGAACTCGAGTTCTGCTTTGTTCTGTGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138745.1-296s1c1
Sequence:CCGGCCACTCACATTAAATTACCAACTCGAGTTGGTAATTTAATGTGAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138745.1-1516s1c1
Sequence:CCGGGCTCTCTTTAATCGTCTGGTACTCGAGTACCAGACGATTAAAGAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138745.1-274s1c1
Sequence:CCGGGCTGAGGAGATTGGGATCAAACTCGAGTTTGATCCCAATCTCCTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138745.1-1516s21c1
Sequence:CCGGGCTCTCTTTAATCGTCTGGTACTCGAGTACCAGACGATTAAAGAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138745.1-2626s21c1
Sequence:CCGGGAAGCACAGAACAAAGCAGAACTCGAGTTCTGCTTTGTTCTGTGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138745.1-296s21c1
Sequence:CCGGCCACTCACATTAAATTACCAACTCGAGTTGGTAATTTAATGTGAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138745.1-2015s21c1
Sequence:CCGGCCAACATTGCACACGGGAATTCTCGAGAATTCCCGTGTGCAATGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138745
VALIDATED
MTHFD1 MISSION shRNA Lentiviral Transduction Particles
methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1, methenyltetrahydrofolate cyclohydrolase, formyltetrahydrofolate synthetase
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000042028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138745.1-2015s1c1
Sequence:CCGGCCAACATTGCACACGGGAATTCTCGAGAATTCCCGTGTGCAATGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138745.1-2626s1c1
Sequence:CCGGGAAGCACAGAACAAAGCAGAACTCGAGTTCTGCTTTGTTCTGTGCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138745.1-296s1c1
Sequence:CCGGCCACTCACATTAAATTACCAACTCGAGTTGGTAATTTAATGTGAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138745.1-1516s1c1
Sequence:CCGGGCTCTCTTTAATCGTCTGGTACTCGAGTACCAGACGATTAAAGAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138745.1-274s1c1
Sequence:CCGGGCTGAGGAGATTGGGATCAAACTCGAGTTTGATCCCAATCTCCTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138745.1-1516s21c1
Sequence:CCGGGCTCTCTTTAATCGTCTGGTACTCGAGTACCAGACGATTAAAGAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138745.1-2626s21c1
Sequence:CCGGGAAGCACAGAACAAAGCAGAACTCGAGTTCTGCTTTGTTCTGTGCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138745.1-296s21c1
Sequence:CCGGCCACTCACATTAAATTACCAACTCGAGTTGGTAATTTAATGTGAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138745.1-2015s21c1
Sequence:CCGGCCAACATTGCACACGGGAATTCTCGAGAATTCCCGTGTGCAATGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005956
VALIDATED
MTHFD1 MISSION shRNA Bacterial Glycerol Stock
methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1, methenyltetrahydrofolate cyclohydrolase, formyltetrahydrofolate synthetase
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000036524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_005956.2-231s1c1
Sequence:CCGGGCTGAAGAGATTGGGATCAAACTCGAGTTTGATCCCAATCTCTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_005956.2-2829s1c1
Sequence:CCGGCCTGAAACAGAACAGGTGAATCTCGAGATTCACCTGTTCTGTTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_005956.2-1428s1c1
Sequence:CCGGGCCATTGATGCTCGGATATTTCTCGAGAAATATCCGAGCATCAATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_005956.2-925s1c1
Sequence:CCGGCCAAGCGTTTCCTGGAGAAATCTCGAGATTTCTCCAGGAAACGCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_005956.2-2559s1c1
Sequence:CCGGGCAGATGACATTGAATTACTTCTCGAGAAGTAATTCAATGTCATCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005956.3-565s21c1
Sequence:CCGGGCTGAAGAGATTGGGATCAAACTCGAGTTTGATCCCAATCTCTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005956.3-1762s21c1
Sequence:CCGGGCCATTGATGCTCGGATATTTCTCGAGAAATATCCGAGCATCAATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005956.3-2893s21c1
Sequence:CCGGGCAGATGACATTGAATTACTTCTCGAGAAGTAATTCAATGTCATCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005956.3-1259s21c1
Sequence:CCGGCCAAGCGTTTCCTGGAGAAATCTCGAGATTTCTCCAGGAAACGCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005956
VALIDATED
MTHFD1 MISSION shRNA shRNA Plasmid DNA
methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1, methenyltetrahydrofolate cyclohydrolase, formyltetrahydrofolate synthetase
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000036524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_005956.2-231s1c1
Sequence:CCGGGCTGAAGAGATTGGGATCAAACTCGAGTTTGATCCCAATCTCTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_005956.2-2829s1c1
Sequence:CCGGCCTGAAACAGAACAGGTGAATCTCGAGATTCACCTGTTCTGTTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_005956.2-1428s1c1
Sequence:CCGGGCCATTGATGCTCGGATATTTCTCGAGAAATATCCGAGCATCAATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_005956.2-925s1c1
Sequence:CCGGCCAAGCGTTTCCTGGAGAAATCTCGAGATTTCTCCAGGAAACGCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_005956.2-2559s1c1
Sequence:CCGGGCAGATGACATTGAATTACTTCTCGAGAAGTAATTCAATGTCATCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005956.3-565s21c1
Sequence:CCGGGCTGAAGAGATTGGGATCAAACTCGAGTTTGATCCCAATCTCTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005956.3-1762s21c1
Sequence:CCGGGCCATTGATGCTCGGATATTTCTCGAGAAATATCCGAGCATCAATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005956.3-2893s21c1
Sequence:CCGGGCAGATGACATTGAATTACTTCTCGAGAAGTAATTCAATGTCATCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005956.3-1259s21c1
Sequence:CCGGCCAAGCGTTTCCTGGAGAAATCTCGAGATTTCTCCAGGAAACGCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005956
VALIDATED
MTHFD1 MISSION shRNA Lentiviral Transduction Particles
methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1, methenyltetrahydrofolate cyclohydrolase, formyltetrahydrofolate synthetase
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000036524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_005956.2-231s1c1
Sequence:CCGGGCTGAAGAGATTGGGATCAAACTCGAGTTTGATCCCAATCTCTTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_005956.2-2829s1c1
Sequence:CCGGCCTGAAACAGAACAGGTGAATCTCGAGATTCACCTGTTCTGTTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_005956.2-1428s1c1
Sequence:CCGGGCCATTGATGCTCGGATATTTCTCGAGAAATATCCGAGCATCAATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_005956.2-925s1c1
Sequence:CCGGCCAAGCGTTTCCTGGAGAAATCTCGAGATTTCTCCAGGAAACGCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_005956.2-2559s1c1
Sequence:CCGGGCAGATGACATTGAATTACTTCTCGAGAAGTAATTCAATGTCATCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005956.3-565s21c1
Sequence:CCGGGCTGAAGAGATTGGGATCAAACTCGAGTTTGATCCCAATCTCTTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005956.3-1762s21c1
Sequence:CCGGGCCATTGATGCTCGGATATTTCTCGAGAAATATCCGAGCATCAATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005956.3-2893s21c1
Sequence:CCGGGCAGATGACATTGAATTACTTCTCGAGAAGTAATTCAATGTCATCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005956.3-1259s21c1
Sequence:CCGGCCAAGCGTTTCCTGGAGAAATCTCGAGATTTCTCCAGGAAACGCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)