EMAIL THIS PAGE TO A FRIEND

MTHFD1L

methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1-like

54 Gene Product Result for
Synonyms: FTHFSDC1 MTC1THFS dJ292B18.2
UniProtKB ID: Q6UB35, Q2TBF3, Q8WVW0, Q96HG8, Q9H789, Q9UFU8
Gene ID:
Human(25902) Summary: The protein encoded by this gene is involved in the synthesis of tetrahydrofolate (THF) in the mitochondrion. THF is important in the de novo synthesis of purines and thymidylate and in the regeneration of methionine from homocysteine. Several transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jun 2011]
Mouse(270685) methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1-like
Rat(361472) methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1-like
Zebrafish(100034522) methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1-like
chicken(421633) methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1-like
domestic cat(101082751) methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1-like
cow(534296) methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1-like
Horse(100063441) methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1-like
dog(476245) methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1-like
naked mole-rat(101720005) methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1-like
Domestic Rabbit(100343064) methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1-like
domestic guinea pig(100733031) methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1-like
sheep(101102245) methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015440 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015440 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015440 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172308 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172308 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172308 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015440 Rosetta Predictions human pricing
NM_001108462 Rosetta Predictions rat pricing
NM_172308 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015440 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00117258 predicted 1701
2 SASI_Hs01_00117259 predicted 883
3 SASI_Hs01_00117260 predicted 1054
4 SASI_Hs01_00117261 predicted 3180
5 SASI_Hs01_00117262 predicted 3151
6 SASI_Hs01_00117263 predicted 1299
7 SASI_Hs01_00117264 predicted 1109
8 SASI_Hs01_00117265 predicted 1993
9 SASI_Hs02_00347826 predicted 1465
10 SASI_Hs01_00117267 predicted 661
11 SASI_Hs01_00117266 predicted 2846
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108462 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00238879 predicted 593
2 SASI_Rn02_00238880 predicted 592
3 SASI_Rn02_00238881 predicted 575
4 SASI_Rn02_00238882 predicted 581
5 SASI_Rn02_00238883 predicted 631
6 SASI_Rn02_00238884 predicted 579
7 SASI_Rn02_00238885 predicted 585
8 SASI_Rn02_00238886 predicted 583
9 SASI_Rn02_00238887 predicted 623
10 SASI_Rn02_00238888 predicted 609
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172308 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00031063 predicted 958
2 SASI_Mm01_00031064 predicted 2221
3 SASI_Mm01_00031065 predicted 1569
4 SASI_Mm01_00031066 predicted 3108
5 SASI_Mm01_00031067 predicted 1806
6 SASI_Mm01_00031068 predicted 2004
7 SASI_Mm02_00343812 predicted 2200
8 SASI_Mm01_00031070 predicted 2473
9 SASI_Mm01_00031071 predicted 2807
10 SASI_Mm02_00343813 predicted 2025
11 SASI_Mm01_00031069 predicted 3056
12 SASI_Mm01_00031072 predicted 1677
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015440
VALIDATED
MTHFD1L MISSION shRNA Bacterial Glycerol Stock
methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1-like
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000229787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015440.3-671s21c1
Sequence:CCGGAGCAGTGAAGCCGAGATTATACTCGAGTATAATCTCGGCTTCACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229790    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015440.3-3442s21c1
Sequence:CCGGTCTGTGGAGTTTCCATTATTTCTCGAGAAATAATGGAAACTCCACAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015440.3-636s21c1
Sequence:GTACCGGGTCTGAACATCACTCACATTTCTCGAGAAATGTGAGTGATGTTCAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015440.3-3173s21c1
Sequence:CCGGACCGAAACAGAACAAGTTAAACTCGAGTTTAACTTGTTCTGTTTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015440.3-2801s21c1
Sequence:CCGGGTGAGAGAGGCTGCGAGTAAACTCGAGTTTACTCGCAGCCTCTCTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015440.3-1987s1c1
Sequence:CCGGGCAGAGAGTATTGGATACAAACTCGAGTTTGTATCCAATACTCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A3
TRC Version: 1 Clone ID:NM_015440.3-1817s1c1
Sequence:CCGGGCTCTGTATAATCGGCTGGTTCTCGAGAACCAGCCGATTATACAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_015440.3-878s1c1
Sequence:CCGGGCCAAAGCTGTAATTGAACTTCTCGAGAAGTTCAATTACAGCTTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015440.3-1347s1c1
Sequence:CCGGCAAGTGACATTGAGATTTCAACTCGAGTTGAAATCTCAATGTCACTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015440.3-2828s1c1
Sequence:CCGGCGATTCCAGTTCCTGTATGATCTCGAGATCATACAGGAACTGGAATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015440
VALIDATED
MTHFD1L MISSION shRNA shRNA Plasmid DNA
methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1-like
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000229787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015440.3-671s21c1
Sequence:CCGGAGCAGTGAAGCCGAGATTATACTCGAGTATAATCTCGGCTTCACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229790    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015440.3-3442s21c1
Sequence:CCGGTCTGTGGAGTTTCCATTATTTCTCGAGAAATAATGGAAACTCCACAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015440.3-636s21c1
Sequence:GTACCGGGTCTGAACATCACTCACATTTCTCGAGAAATGTGAGTGATGTTCAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015440.3-3173s21c1
Sequence:CCGGACCGAAACAGAACAAGTTAAACTCGAGTTTAACTTGTTCTGTTTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015440.3-2801s21c1
Sequence:CCGGGTGAGAGAGGCTGCGAGTAAACTCGAGTTTACTCGCAGCCTCTCTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015440.3-1987s1c1
Sequence:CCGGGCAGAGAGTATTGGATACAAACTCGAGTTTGTATCCAATACTCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A3
TRC Version: 1 Clone ID:NM_015440.3-1817s1c1
Sequence:CCGGGCTCTGTATAATCGGCTGGTTCTCGAGAACCAGCCGATTATACAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_015440.3-878s1c1
Sequence:CCGGGCCAAAGCTGTAATTGAACTTCTCGAGAAGTTCAATTACAGCTTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015440.3-1347s1c1
Sequence:CCGGCAAGTGACATTGAGATTTCAACTCGAGTTGAAATCTCAATGTCACTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015440.3-2828s1c1
Sequence:CCGGCGATTCCAGTTCCTGTATGATCTCGAGATCATACAGGAACTGGAATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015440
VALIDATED
MTHFD1L MISSION shRNA Lentiviral Transduction Particles
methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1-like
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000229787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015440.3-671s21c1
Sequence:CCGGAGCAGTGAAGCCGAGATTATACTCGAGTATAATCTCGGCTTCACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229790    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015440.3-3442s21c1
Sequence:CCGGTCTGTGGAGTTTCCATTATTTCTCGAGAAATAATGGAAACTCCACAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015440.3-636s21c1
Sequence:GTACCGGGTCTGAACATCACTCACATTTCTCGAGAAATGTGAGTGATGTTCAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015440.3-3173s21c1
Sequence:CCGGACCGAAACAGAACAAGTTAAACTCGAGTTTAACTTGTTCTGTTTCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015440.3-2801s21c1
Sequence:CCGGGTGAGAGAGGCTGCGAGTAAACTCGAGTTTACTCGCAGCCTCTCTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015440.3-1987s1c1
Sequence:CCGGGCAGAGAGTATTGGATACAAACTCGAGTTTGTATCCAATACTCTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A3
TRC Version: 1 Clone ID:NM_015440.3-1817s1c1
Sequence:CCGGGCTCTGTATAATCGGCTGGTTCTCGAGAACCAGCCGATTATACAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_015440.3-878s1c1
Sequence:CCGGGCCAAAGCTGTAATTGAACTTCTCGAGAAGTTCAATTACAGCTTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015440.3-1347s1c1
Sequence:CCGGCAAGTGACATTGAGATTTCAACTCGAGTTGAAATCTCAATGTCACTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015440.3-2828s1c1
Sequence:CCGGCGATTCCAGTTCCTGTATGATCTCGAGATCATACAGGAACTGGAATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172308
VALIDATED
MTHFD1L MISSION shRNA Bacterial Glycerol Stock
methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1-like
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000075943    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172308.2-3319s1c1
Sequence:CCGGCGCTTCCTCATACAAGATTAACTCGAGTTAATCTTGTATGAGGAAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172308.2-1263s1c1
Sequence:CCGGCCTTGCCAAGGAGATAGGATTCTCGAGAATCCTATCTCCTTGGCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172308.2-1684s1c1
Sequence:CCGGGCTCTCTACAATCGACTGGTTCTCGAGAACCAGTCGATTGTAGAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172308.2-632s1c1
Sequence:CCGGGCAACAAAGTTCTCAATGCTTCTCGAGAAGCATTGAGAACTTTGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172308
VALIDATED
MTHFD1L MISSION shRNA shRNA Plasmid DNA
methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1-like
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000075943    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172308.2-3319s1c1
Sequence:CCGGCGCTTCCTCATACAAGATTAACTCGAGTTAATCTTGTATGAGGAAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172308.2-1263s1c1
Sequence:CCGGCCTTGCCAAGGAGATAGGATTCTCGAGAATCCTATCTCCTTGGCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172308.2-1684s1c1
Sequence:CCGGGCTCTCTACAATCGACTGGTTCTCGAGAACCAGTCGATTGTAGAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172308.2-632s1c1
Sequence:CCGGGCAACAAAGTTCTCAATGCTTCTCGAGAAGCATTGAGAACTTTGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172308
VALIDATED
MTHFD1L MISSION shRNA Lentiviral Transduction Particles
methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1-like
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000075943    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172308.2-3319s1c1
Sequence:CCGGCGCTTCCTCATACAAGATTAACTCGAGTTAATCTTGTATGAGGAAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172308.2-1263s1c1
Sequence:CCGGCCTTGCCAAGGAGATAGGATTCTCGAGAATCCTATCTCCTTGGCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172308.2-1684s1c1
Sequence:CCGGGCTCTCTACAATCGACTGGTTCTCGAGAACCAGTCGATTGTAGAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172308.2-632s1c1
Sequence:CCGGGCAACAAAGTTCTCAATGCTTCTCGAGAAGCATTGAGAACTTTGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)