EMAIL THIS PAGE TO A FRIEND

MTHFD2

methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase

143 Gene Product Result for
Synonyms: NMDMC
UniProtKB ID: P13995, Q53G90, Q53GV5, Q53S36
Gene ID:
Human(10797) Summary: This gene encodes a nuclear-encoded mitochondrial bifunctional enzyme with methylenetetrahydrofolate dehydrogenase and methenyltetrahydrofolate cyclohydrolase activities. The enzyme functions as a homodimer and is unique in its absolute requirement for magnesium and inorganic phosphate. Formation of the enzyme-magnesium complex allows binding of NAD. Alternative splicing results in two different transcripts, one protein-coding and the other not protein-coding. This gene has a pseudogene on chromosome 7. [provided by RefSeq, Mar 2009]
Mouse(17768) methylenetetrahydrofolate dehydrogenase (NAD+ dependent), methenyltetrahydrofolate cyclohydrolase
Rat(680308) methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase
Zebrafish(100004977) methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase
chicken(426126) methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase
domestic cat(101083836) methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase
cow(517539) methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase
Horse(100053990) methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase
dog(483107) methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase
domestic guinea pig(100715129) methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase
naked mole-rat(101705997) methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008638 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008638 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008638 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006636 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006636 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006636 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001040409 Rosetta Predictions human pricing
NM_006636 Rosetta Predictions human pricing
NM_001109398 Rosetta Predictions rat pricing
NM_008638 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040409 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00074503 predicted 1273
2 SASI_Hs01_00074504 predicted 660
3 SASI_Hs01_00074505 predicted 669
4 SASI_Hs01_00074506 predicted 1038
5 SASI_Hs02_00308941 predicted 785
6 SASI_Hs02_00308942 predicted 940
7 SASI_Hs02_00308943 predicted 601
8 SASI_Hs01_00074510 predicted 930
9 SASI_Hs01_00074511 predicted 921
10 SASI_Hs02_00308944 predicted 622
11 SASI_Hs01_00074507 predicted 986
12 SASI_Hs01_00074508 predicted 669
13 SASI_Hs01_00074509 predicted 995
14 SASI_Hs01_00074512 predicted 912
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006636 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00150602 predicted 1176
2 SASI_Hs01_00150603 predicted 565
3 SASI_Hs01_00150604 predicted 566
4 SASI_Hs01_00150605 predicted 936
5 SASI_Hs02_00341991 predicted 687
6 SASI_Hs02_00341992 predicted 846
7 SASI_Hs02_00341993 predicted 503
8 SASI_Hs01_00150609 predicted 831
9 SASI_Hs01_00150610 predicted 818
10 SASI_Hs02_00341994 predicted 525
11 SASI_Hs01_00150606 predicted 888
12 SASI_Hs01_00150607 predicted 575
13 SASI_Hs01_00150608 predicted 887
14 SASI_Hs01_00150611 predicted 815
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109398 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00248026 predicted 276
2 SASI_Rn02_00248027 predicted 1037
3 SASI_Rn02_00248028 predicted 308
4 SASI_Rn02_00248029 predicted 525
5 SASI_Rn02_00248030 predicted 354
6 SASI_Rn02_00248031 predicted 928
7 SASI_Rn02_00248032 predicted 404
8 SASI_Rn02_00248033 predicted 971
9 SASI_Rn02_00248034 predicted 536
10 SASI_Rn02_00248035 predicted 380
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008638 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00175595 predicted 558
2 SASI_Mm01_00175597 predicted 315
3 SASI_Mm01_00175598 predicted 359
4 SASI_Mm02_00314360 predicted 683
5 SASI_Mm01_00175599 predicted 752
6 SASI_Mm01_00175600 predicted 430
7 SASI_Mm01_00175602 predicted 441
8 SASI_Mm02_00314361 predicted 298
9 SASI_Mm01_00175603 predicted 976
10 SASI_Mm01_00175604 predicted 375
11 SASI_Mm01_00175596 predicted 284
12 SASI_Mm01_00175601 predicted 544
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008638
VALIDATED
MTHFD2 MISSION shRNA Bacterial Glycerol Stock
methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000308709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008638.2-319s21c1
Sequence:CCGGCACTCCTATGTTCTCAACAAACTCGAGTTTGTTGAGAACATAGGAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008638.1-1032s1c1
Sequence:CCGGGCTCATGAAGAACACCATTATCTCGAGATAATGGTGTTCTTCATGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008638.1-319s1c1
Sequence:CCGGCACTCCTATGTTCTCAACAAACTCGAGTTTGTTGAGAACATAGGAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008638.1-884s1c1
Sequence:CCGGCGGTCATCGATGTGGGAATAACTCGAGTTATTCCCACATCGATGACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008638.1-175s1c1
Sequence:CCGGCGAAATGAAGCCGTTGTCATTCTCGAGAATGACAACGGCTTCATTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008638.1-631s1c1
Sequence:CCGGCGAACAGGCATTCCAACCTTACTCGAGTAAGGTTGGAATGCCTGTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008638.2-175s21c1
Sequence:CCGGCGAAATGAAGCCGTTGTCATTCTCGAGAATGACAACGGCTTCATTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008638.2-884s21c1
Sequence:CCGGCGGTCATCGATGTGGGAATAACTCGAGTTATTCCCACATCGATGACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008638.2-631s21c1
Sequence:CCGGCGAACAGGCATTCCAACCTTACTCGAGTAAGGTTGGAATGCCTGTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008638.2-1032s21c1
Sequence:CCGGGCTCATGAAGAACACCATTATCTCGAGATAATGGTGTTCTTCATGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008638
VALIDATED
MTHFD2 MISSION shRNA shRNA Plasmid DNA
methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000308709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008638.2-319s21c1
Sequence:CCGGCACTCCTATGTTCTCAACAAACTCGAGTTTGTTGAGAACATAGGAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008638.1-1032s1c1
Sequence:CCGGGCTCATGAAGAACACCATTATCTCGAGATAATGGTGTTCTTCATGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008638.1-319s1c1
Sequence:CCGGCACTCCTATGTTCTCAACAAACTCGAGTTTGTTGAGAACATAGGAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008638.1-884s1c1
Sequence:CCGGCGGTCATCGATGTGGGAATAACTCGAGTTATTCCCACATCGATGACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008638.1-175s1c1
Sequence:CCGGCGAAATGAAGCCGTTGTCATTCTCGAGAATGACAACGGCTTCATTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008638.1-631s1c1
Sequence:CCGGCGAACAGGCATTCCAACCTTACTCGAGTAAGGTTGGAATGCCTGTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008638.2-175s21c1
Sequence:CCGGCGAAATGAAGCCGTTGTCATTCTCGAGAATGACAACGGCTTCATTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008638.2-884s21c1
Sequence:CCGGCGGTCATCGATGTGGGAATAACTCGAGTTATTCCCACATCGATGACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008638.2-631s21c1
Sequence:CCGGCGAACAGGCATTCCAACCTTACTCGAGTAAGGTTGGAATGCCTGTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008638.2-1032s21c1
Sequence:CCGGGCTCATGAAGAACACCATTATCTCGAGATAATGGTGTTCTTCATGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008638
VALIDATED
MTHFD2 MISSION shRNA Lentiviral Transduction Particles
methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000308709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008638.2-319s21c1
Sequence:CCGGCACTCCTATGTTCTCAACAAACTCGAGTTTGTTGAGAACATAGGAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008638.1-1032s1c1
Sequence:CCGGGCTCATGAAGAACACCATTATCTCGAGATAATGGTGTTCTTCATGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008638.1-319s1c1
Sequence:CCGGCACTCCTATGTTCTCAACAAACTCGAGTTTGTTGAGAACATAGGAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008638.1-884s1c1
Sequence:CCGGCGGTCATCGATGTGGGAATAACTCGAGTTATTCCCACATCGATGACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008638.1-175s1c1
Sequence:CCGGCGAAATGAAGCCGTTGTCATTCTCGAGAATGACAACGGCTTCATTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008638.1-631s1c1
Sequence:CCGGCGAACAGGCATTCCAACCTTACTCGAGTAAGGTTGGAATGCCTGTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008638.2-175s21c1
Sequence:CCGGCGAAATGAAGCCGTTGTCATTCTCGAGAATGACAACGGCTTCATTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008638.2-884s21c1
Sequence:CCGGCGGTCATCGATGTGGGAATAACTCGAGTTATTCCCACATCGATGACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008638.2-631s21c1
Sequence:CCGGCGAACAGGCATTCCAACCTTACTCGAGTAAGGTTGGAATGCCTGTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008638.2-1032s21c1
Sequence:CCGGGCTCATGAAGAACACCATTATCTCGAGATAATGGTGTTCTTCATGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006636
VALIDATED
MTHFD2 MISSION shRNA Bacterial Glycerol Stock
methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000036550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_006636.2-548s1c1
Sequence:CCGGCGAATGTGTTTGGATCAGTATCTCGAGATACTGATCCAAACACATTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006636.2-302s1c1
Sequence:CCGGCACTCCTATGTCCTCAACAAACTCGAGTTTGTTGAGGACATAGGAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_006636.2-772s1c1
Sequence:CCGGGCAGTTGAAGAAACATACAATCTCGAGATTGTATGTTTCTTCAACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1 Clone ID:NM_006636.2-1067s1c1
Sequence:CCGGCGAGAAGTGCTGAAGTCTAAACTCGAGTTTAGACTTCAGCACTTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_006636.2-962s1c1
Sequence:CCGGGCTGGGTATATCACTCCAGTTCTCGAGAACTGGAGTGATATACCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006636.3-323s21c1
Sequence:CCGGCACTCCTATGTCCTCAACAAACTCGAGTTTGTTGAGGACATAGGAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006636.3-983s21c1
Sequence:CCGGGCTGGGTATATCACTCCAGTTCTCGAGAACTGGAGTGATATACCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006636.3-569s21c1
Sequence:CCGGCGAATGTGTTTGGATCAGTATCTCGAGATACTGATCCAAACACATTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006636.3-793s21c1
Sequence:CCGGGCAGTTGAAGAAACATACAATCTCGAGATTGTATGTTTCTTCAACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006636
VALIDATED
MTHFD2 MISSION shRNA shRNA Plasmid DNA
methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000036550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_006636.2-548s1c1
Sequence:CCGGCGAATGTGTTTGGATCAGTATCTCGAGATACTGATCCAAACACATTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006636.2-302s1c1
Sequence:CCGGCACTCCTATGTCCTCAACAAACTCGAGTTTGTTGAGGACATAGGAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_006636.2-772s1c1
Sequence:CCGGGCAGTTGAAGAAACATACAATCTCGAGATTGTATGTTTCTTCAACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1 Clone ID:NM_006636.2-1067s1c1
Sequence:CCGGCGAGAAGTGCTGAAGTCTAAACTCGAGTTTAGACTTCAGCACTTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_006636.2-962s1c1
Sequence:CCGGGCTGGGTATATCACTCCAGTTCTCGAGAACTGGAGTGATATACCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006636.3-323s21c1
Sequence:CCGGCACTCCTATGTCCTCAACAAACTCGAGTTTGTTGAGGACATAGGAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006636.3-983s21c1
Sequence:CCGGGCTGGGTATATCACTCCAGTTCTCGAGAACTGGAGTGATATACCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006636.3-569s21c1
Sequence:CCGGCGAATGTGTTTGGATCAGTATCTCGAGATACTGATCCAAACACATTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006636.3-793s21c1
Sequence:CCGGGCAGTTGAAGAAACATACAATCTCGAGATTGTATGTTTCTTCAACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006636
VALIDATED
MTHFD2 MISSION shRNA Lentiviral Transduction Particles
methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000036550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_006636.2-548s1c1
Sequence:CCGGCGAATGTGTTTGGATCAGTATCTCGAGATACTGATCCAAACACATTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006636.2-302s1c1
Sequence:CCGGCACTCCTATGTCCTCAACAAACTCGAGTTTGTTGAGGACATAGGAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_006636.2-772s1c1
Sequence:CCGGGCAGTTGAAGAAACATACAATCTCGAGATTGTATGTTTCTTCAACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1 Clone ID:NM_006636.2-1067s1c1
Sequence:CCGGCGAGAAGTGCTGAAGTCTAAACTCGAGTTTAGACTTCAGCACTTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_006636.2-962s1c1
Sequence:CCGGGCTGGGTATATCACTCCAGTTCTCGAGAACTGGAGTGATATACCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006636.3-323s21c1
Sequence:CCGGCACTCCTATGTCCTCAACAAACTCGAGTTTGTTGAGGACATAGGAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006636.3-983s21c1
Sequence:CCGGGCTGGGTATATCACTCCAGTTCTCGAGAACTGGAGTGATATACCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006636.3-569s21c1
Sequence:CCGGCGAATGTGTTTGGATCAGTATCTCGAGATACTGATCCAAACACATTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006636.3-793s21c1
Sequence:CCGGGCAGTTGAAGAAACATACAATCTCGAGATTGTATGTTTCTTCAACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)