EMAIL THIS PAGE TO A FRIEND

MTHFD2L

methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2-like

186 Gene Product Result for
UniProtKB ID: Q9H903, Q6P079, Q8N560
Gene ID:
Mouse(665563) methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2-like
Rat(305248) methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2-like
naked mole-rat(101703156) methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2-like
sheep(101104908) methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2-like
Zebrafish(327496) methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2-like
cow(536269) methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2-like
domestic cat(101093354) methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2-like
dog(482197) methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2-like
chicken(770327) methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026788 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026788 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026788 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001004346 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001004346 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001004346 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004346 Rosetta Predictions human pricing
NM_001107211 Rosetta Predictions rat pricing
XM_223282 Rosetta Predictions rat pricing
NM_026788 Rosetta Predictions mouse pricing
XM_978952 Rosetta Predictions mouse pricing
XM_978981 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004346 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00119077 predicted 935
2 SASI_Hs01_00119078 predicted 1171
3 SASI_Hs02_00304564 predicted 1145
4 SASI_Hs01_00119080 predicted 963
5 SASI_Hs02_00304565 predicted 616
6 SASI_Hs01_00119081 predicted 912
7 SASI_Hs01_00119083 predicted 967
8 SASI_Hs02_00304566 predicted 502
9 SASI_Hs02_00304567 predicted 619
10 SASI_Hs02_00304568 predicted 1176
11 SASI_Hs01_00119076 predicted 943
12 SASI_Hs01_00119079 predicted 918
13 SASI_Hs01_00119082 predicted 1041
14 SASI_Hs01_00119084 predicted 886
15 SASI_Hs01_00119085 predicted 994
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107211 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00226605 predicted 1166
2 SASI_Rn02_00226606 predicted 571
3 SASI_Rn02_00226607 predicted 944
4 SASI_Rn02_00226608 predicted 868
5 SASI_Rn02_00226609 predicted 579
6 SASI_Rn02_00226610 predicted 456
7 SASI_Rn02_00226611 predicted 982
8 SASI_Rn02_00226612 predicted 1146
9 SASI_Rn02_00226613 predicted 228
10 SASI_Rn02_00226614 predicted 1131
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_223282 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00193997 predicted 1111
2 SASI_Rn01_00193998 predicted 517
3 SASI_Rn01_00193999 predicted 894
4 SASI_Rn01_00194000 predicted 868
5 SASI_Rn01_00194001 predicted 820
6 SASI_Rn01_00194002 predicted 524
7 SASI_Rn01_00194003 predicted 401
8 SASI_Rn01_00194004 predicted 937
9 SASI_Rn01_00194005 predicted 1095
10 SASI_Rn01_00194006 predicted 1080
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026788 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00330887 predicted 690
2 SASI_Mm02_00330888 predicted 594
3 SASI_Mm02_00330889 predicted 512
4 SASI_Mm02_00330890 predicted 935
5 SASI_Mm02_00330891 predicted 256
6 SASI_Mm02_00330892 predicted 1010
7 SASI_Mm02_00330893 predicted 307
8 SASI_Mm02_00330894 predicted 1164
9 SASI_Mm02_00330895 predicted 894
10 SASI_Mm02_00330896 predicted 380
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_978952 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00237656 predicted 280
2 SASI_Mm01_00237657 predicted 288
3 SASI_Mm01_00237658 predicted 466
4 SASI_Mm01_00237659 predicted 307
5 SASI_Mm01_00237660 predicted 342
6 SASI_Mm01_00237661 predicted 277
7 SASI_Mm01_00237662 predicted 271
8 SASI_Mm01_00237663 predicted 260
9 SASI_Mm01_00237664 predicted 314
10 SASI_Mm01_00237665 predicted 341
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_978981 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00241677 predicted 619
2 SASI_Mm01_00241678 predicted 513
3 SASI_Mm01_00241679 predicted 430
4 SASI_Mm01_00241680 predicted 862
5 SASI_Mm01_00241681 predicted 937
6 SASI_Mm01_00241682 predicted 233
7 SASI_Mm01_00241683 predicted 1089
8 SASI_Mm01_00241684 predicted 817
9 SASI_Mm01_00241685 predicted 302
10 SASI_Mm01_00241686 predicted 1100
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026788
VALIDATED
MTHFD2L MISSION shRNA Bacterial Glycerol Stock
methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2-like
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026788.1-899s21c1
Sequence:CCGGGGGTATTCCCAGGTTGATTACCTCGAGGTAATCAACCTGGGAATACCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026788.1-507s21c1
Sequence:CCGGCCAAGAGTCAGCGGTATATTACTCGAGTAATATACCGCTGACTCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256659    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026788.1-2036s21c1
Sequence:CCGGGAAATGTGTGTGACCATTATTCTCGAGAATAATGGTCACACACATTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026788.1-427s21c1
Sequence:CCGGTCTGCAGTGAGCTCATCATAACTCGAGTTATGATGAGCTCACTGCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026788.1-953s21c1
Sequence:CCGGTGATGTGGGTATCAACTATATCTCGAGATATAGTTGATACCCACATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026788
VALIDATED
MTHFD2L MISSION shRNA shRNA Plasmid DNA
methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2-like
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026788.1-899s21c1
Sequence:CCGGGGGTATTCCCAGGTTGATTACCTCGAGGTAATCAACCTGGGAATACCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026788.1-507s21c1
Sequence:CCGGCCAAGAGTCAGCGGTATATTACTCGAGTAATATACCGCTGACTCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256659    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026788.1-2036s21c1
Sequence:CCGGGAAATGTGTGTGACCATTATTCTCGAGAATAATGGTCACACACATTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026788.1-427s21c1
Sequence:CCGGTCTGCAGTGAGCTCATCATAACTCGAGTTATGATGAGCTCACTGCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026788.1-953s21c1
Sequence:CCGGTGATGTGGGTATCAACTATATCTCGAGATATAGTTGATACCCACATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026788
VALIDATED
MTHFD2L MISSION shRNA Lentiviral Transduction Particles
methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2-like
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026788.1-899s21c1
Sequence:CCGGGGGTATTCCCAGGTTGATTACCTCGAGGTAATCAACCTGGGAATACCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026788.1-507s21c1
Sequence:CCGGCCAAGAGTCAGCGGTATATTACTCGAGTAATATACCGCTGACTCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256659    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026788.1-2036s21c1
Sequence:CCGGGAAATGTGTGTGACCATTATTCTCGAGAATAATGGTCACACACATTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026788.1-427s21c1
Sequence:CCGGTCTGCAGTGAGCTCATCATAACTCGAGTTATGATGAGCTCACTGCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026788.1-953s21c1
Sequence:CCGGTGATGTGGGTATCAACTATATCTCGAGATATAGTTGATACCCACATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001004346
MTHFD2L MISSION shRNA Bacterial Glycerol Stock
methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2-like
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000078408    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004346.1-1856s1c1
Sequence:CCGGCCCTCTTCTGTTACAGAATTTCTCGAGAAATTCTGTAACAGAAGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004346.1-611s1c1
Sequence:CCGGGCAGGTATTCCAAAGTTGATTCTCGAGAATCAACTTTGGAATACCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004346.1-214s1c1
Sequence:CCGGCGTGGTCGTCTGGTCCTACTACTCGAGTAGTAGGACCAGACGACCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004346.1-755s1c1
Sequence:CCGGGCTGGCTTTATCACTCCAGTTCTCGAGAACTGGAGTGATAAAGCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004346.1-620s1c1
Sequence:CCGGCCAAAGTTGATTACGTCTGATCTCGAGATCAGACGTAATCAACTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001004346
MTHFD2L MISSION shRNA shRNA Plasmid DNA
methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2-like
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000078408    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004346.1-1856s1c1
Sequence:CCGGCCCTCTTCTGTTACAGAATTTCTCGAGAAATTCTGTAACAGAAGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004346.1-611s1c1
Sequence:CCGGGCAGGTATTCCAAAGTTGATTCTCGAGAATCAACTTTGGAATACCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004346.1-214s1c1
Sequence:CCGGCGTGGTCGTCTGGTCCTACTACTCGAGTAGTAGGACCAGACGACCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004346.1-755s1c1
Sequence:CCGGGCTGGCTTTATCACTCCAGTTCTCGAGAACTGGAGTGATAAAGCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004346.1-620s1c1
Sequence:CCGGCCAAAGTTGATTACGTCTGATCTCGAGATCAGACGTAATCAACTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001004346
MTHFD2L MISSION shRNA Lentiviral Transduction Particles
methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2-like
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000078408    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004346.1-1856s1c1
Sequence:CCGGCCCTCTTCTGTTACAGAATTTCTCGAGAAATTCTGTAACAGAAGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004346.1-611s1c1
Sequence:CCGGGCAGGTATTCCAAAGTTGATTCTCGAGAATCAACTTTGGAATACCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004346.1-214s1c1
Sequence:CCGGCGTGGTCGTCTGGTCCTACTACTCGAGTAGTAGGACCAGACGACCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004346.1-755s1c1
Sequence:CCGGGCTGGCTTTATCACTCCAGTTCTCGAGAACTGGAGTGATAAAGCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004346.1-620s1c1
Sequence:CCGGCCAAAGTTGATTACGTCTGATCTCGAGATCAGACGTAATCAACTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)