EMAIL THIS PAGE TO A FRIEND

MTHFR

methylenetetrahydrofolate reductase (NAD(P)H)

114 Gene Product Result for
UniProtKB ID: P42898, B2R7A6, Q5SNW9, Q7Z6M6, Q9UQR2
Gene ID:
Human(4524) Summary: The protein encoded by this gene catalyzes the conversion of 5,10-methylenetetrahydrofolate to 5-methyltetrahydrofolate, a co-substrate for homocysteine remethylation to methionine. Genetic variation in this gene influences susceptibility to occlusive vascular disease, neural tube defects, colon cancer and acute leukemia, and mutations in this gene are associated with methylenetetrahydrofolate reductase deficiency.[provided by RefSeq, Oct 2009]
Mouse(17769) 5,10-methylenetetrahydrofolate reductase
Rat(362657) methylenetetrahydrofolate reductase (NAD(P)H)
Zebrafish(567547) methylenetetrahydrofolate reductase (NAD(P)H)
chicken(419489) methylenetetrahydrofolate reductase (NAD(P)H)
Horse(100050979) methylenetetrahydrofolate reductase (NAD(P)H)
cow(497032) methylenetetrahydrofolate reductase (NAD(P)H)
domestic cat(101100576) methylenetetrahydrofolate reductase (NAD(P)H)
dog(478230) methylenetetrahydrofolate reductase (NAD(P)H)
sheep(101111645) methylenetetrahydrofolate reductase (NAD(P)H)
domestic guinea pig(100715703) methylenetetrahydrofolate reductase (NAD(P)H)
naked mole-rat(101719335) methylenetetrahydrofolate reductase (NAD(P)H)
Domestic Rabbit(100352874) methylenetetrahydrofolate reductase (NAD(P)H)
Gene Class: Dehydrogenase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4301860 Anti-MTHFR affinity isolated antibody mouse, human
immunohistochemistry, western blot pricing
SAB4301915 Anti-MTHFR affinity isolated antibody human, mouse
immunohistochemistry pricing
SAB2501754 Anti-MTHFR antibody produced in goat affinity isolated antibody, buffered aqueous solution canine, mouse, bovine, pig, rat, human
ELISA, western blot pricing
SAB1406148 Anti-MTHFR antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB1412392 ANTI-MTHFR antibody produced in mouse clone 1F10, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1410801 Anti-MTHFR antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
western blot pricing
HPA063389 Anti-MTHFR antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing
WH0004524M1 Monoclonal Anti-MTHFR antibody produced in mouse clone 2H9, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1404091 Monoclonal Anti-MTHFR antibody produced in mouse clone 1G12, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB5300417 Monoclonal Anti-MTHFR antibody produced in mouse clone 5D3, ascites fluid rat, human
ELISA, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010840 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010840 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010840 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005957 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005957 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005957 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005957 Rosetta Predictions human pricing
XM_001074061 Rosetta Predictions rat pricing
XM_342975 Rosetta Predictions rat pricing
NM_010840 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005957 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00228224 predicted 1780
2 SASI_Hs01_00228225 predicted 841
3 SASI_Hs01_00228226 predicted 255
4 SASI_Hs01_00228227 predicted 1460
5 SASI_Hs01_00228228 predicted 731
6 SASI_Hs01_00228229 predicted 1783
7 SASI_Hs01_00228230 predicted 366
8 SASI_Hs01_00228231 predicted 1482
9 SASI_Hs01_00228232 predicted 366
10 SASI_Hs02_00340621 predicted 1621
11 SASI_Hs01_00228233 predicted 1071
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001074061 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00344917 predicted 596
2 SASI_Rn02_00344918 predicted 677
3 SASI_Rn02_00344919 predicted 832
4 SASI_Rn02_00344920 predicted 790
5 SASI_Rn02_00344921 predicted 1636
6 SASI_Rn02_00344922 predicted 1624
7 SASI_Rn02_00344923 predicted 1306
8 SASI_Rn02_00344924 predicted 859
9 SASI_Rn02_00344925 predicted 692
10 SASI_Rn02_00344926 predicted 1374
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342975 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00395151 predicted 400
2 SASI_Rn02_00395152 predicted 588
3 SASI_Rn02_00395153 predicted 357
4 SASI_Rn02_00395154 predicted 683
5 SASI_Rn02_00395155 predicted 479
6 SASI_Rn02_00395156 predicted 795
7 SASI_Rn02_00395157 predicted 693
8 SASI_Rn02_00395158 predicted 260
9 SASI_Rn02_00395159 predicted 350
10 SASI_Rn02_00395160 predicted 355
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010840 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00070293 predicted 1925
2 SASI_Mm01_00070294 predicted 1692
3 SASI_Mm01_00070295 predicted 935
4 SASI_Mm01_00070296 predicted 950
5 SASI_Mm02_00319482 predicted 1789
6 SASI_Mm01_00070297 predicted 317
7 SASI_Mm01_00070298 predicted 986
8 SASI_Mm01_00070299 predicted 1217
9 SASI_Mm01_00070300 predicted 881
10 SASI_Mm01_00070302 predicted 1658
11 SASI_Mm01_00070301 predicted 1555
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010840
MTHFR MISSION shRNA Bacterial Glycerol Stock
methylenetetrahydrofolate reductase (NAD(P)H)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000042177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010840.2-472s1c1
Sequence:CCGGGCTTGGAAACCATCCTGCATACTCGAGTATGCAGGATGGTTTCCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010840.2-551s1c1
Sequence:CCGGGCTGGGCCTGAAGAACATAATCTCGAGATTATGTTCTTCAGGCCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010840.2-954s1c1
Sequence:CCGGGATGTAATTGAGCCCATCAAACTCGAGTTTGATGGGCTCAATTACATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010840.2-838s1c1
Sequence:CCGGGCACAGAGATAGGCATCTCTTCTCGAGAAGAGATGCCTATCTCTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010840.2-1925s1c1
Sequence:CCGGCCGCATGATCATCCAATACATCTCGAGATGTATTGGATGATCATGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010840
MTHFR MISSION shRNA shRNA Plasmid DNA
methylenetetrahydrofolate reductase (NAD(P)H)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000042177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010840.2-472s1c1
Sequence:CCGGGCTTGGAAACCATCCTGCATACTCGAGTATGCAGGATGGTTTCCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010840.2-551s1c1
Sequence:CCGGGCTGGGCCTGAAGAACATAATCTCGAGATTATGTTCTTCAGGCCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010840.2-954s1c1
Sequence:CCGGGATGTAATTGAGCCCATCAAACTCGAGTTTGATGGGCTCAATTACATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010840.2-838s1c1
Sequence:CCGGGCACAGAGATAGGCATCTCTTCTCGAGAAGAGATGCCTATCTCTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010840.2-1925s1c1
Sequence:CCGGCCGCATGATCATCCAATACATCTCGAGATGTATTGGATGATCATGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010840
MTHFR MISSION shRNA Lentiviral Transduction Particles
methylenetetrahydrofolate reductase (NAD(P)H)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000042177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010840.2-472s1c1
Sequence:CCGGGCTTGGAAACCATCCTGCATACTCGAGTATGCAGGATGGTTTCCAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010840.2-551s1c1
Sequence:CCGGGCTGGGCCTGAAGAACATAATCTCGAGATTATGTTCTTCAGGCCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010840.2-954s1c1
Sequence:CCGGGATGTAATTGAGCCCATCAAACTCGAGTTTGATGGGCTCAATTACATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010840.2-838s1c1
Sequence:CCGGGCACAGAGATAGGCATCTCTTCTCGAGAAGAGATGCCTATCTCTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010840.2-1925s1c1
Sequence:CCGGCCGCATGATCATCCAATACATCTCGAGATGTATTGGATGATCATGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005957
VALIDATED
MTHFR MISSION shRNA Bacterial Glycerol Stock
methylenetetrahydrofolate reductase (NAD(P)H)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000046472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005957.2-1669s1c1
Sequence:CCGGCTTGTCAATGTGAAGGGTGAACTCGAGTTCACCCTTCACATTGACAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046468    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005957.2-5743s1c1
Sequence:CCGGCCTCAGTTTCTCCATCAGCTTCTCGAGAAGCTGATGGAGAAACTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005957.2-748s1c1
Sequence:CCGGGCTGACACATTCTTCCGCTTTCTCGAGAAAGCGGAAGAATGTGTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005957.2-597s1c1
Sequence:CCGGCCGAAGTGAGTTTGGTGACTACTCGAGTAGTCACCAAACTCACTTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005957.2-128s1c1
Sequence:CCGGCCAAAGATAGTTCGAGATGTTCTCGAGAACATCTCGAACTATCTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005957.3-1477s21c1
Sequence:CCGGCTTTGAAGTCTTCGTTCTTTACTCGAGTAAAGAACGAAGACTTCAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005957.3-1056s21c1
Sequence:CCGGATGCTGCCATCCGCAACTATGCTCGAGCATAGTTGCGGATGGCAGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005957.3-1776s21c1
Sequence:CCGGAGTACGAGCTCCGGGTTAATTCTCGAGAATTAACCCGGAGCTCGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235026    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005957.3-4784s21c1
Sequence:CCGGTTACCGTAGCCTCCGTTTATGCTCGAGCATAAACGGAGGCTACGGTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005957
VALIDATED
MTHFR MISSION shRNA shRNA Plasmid DNA
methylenetetrahydrofolate reductase (NAD(P)H)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000046472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005957.2-1669s1c1
Sequence:CCGGCTTGTCAATGTGAAGGGTGAACTCGAGTTCACCCTTCACATTGACAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046468    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005957.2-5743s1c1
Sequence:CCGGCCTCAGTTTCTCCATCAGCTTCTCGAGAAGCTGATGGAGAAACTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005957.2-748s1c1
Sequence:CCGGGCTGACACATTCTTCCGCTTTCTCGAGAAAGCGGAAGAATGTGTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005957.2-597s1c1
Sequence:CCGGCCGAAGTGAGTTTGGTGACTACTCGAGTAGTCACCAAACTCACTTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005957.2-128s1c1
Sequence:CCGGCCAAAGATAGTTCGAGATGTTCTCGAGAACATCTCGAACTATCTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005957.3-1477s21c1
Sequence:CCGGCTTTGAAGTCTTCGTTCTTTACTCGAGTAAAGAACGAAGACTTCAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005957.3-1056s21c1
Sequence:CCGGATGCTGCCATCCGCAACTATGCTCGAGCATAGTTGCGGATGGCAGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005957.3-1776s21c1
Sequence:CCGGAGTACGAGCTCCGGGTTAATTCTCGAGAATTAACCCGGAGCTCGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235026    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005957.3-4784s21c1
Sequence:CCGGTTACCGTAGCCTCCGTTTATGCTCGAGCATAAACGGAGGCTACGGTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005957
VALIDATED
MTHFR MISSION shRNA Lentiviral Transduction Particles
methylenetetrahydrofolate reductase (NAD(P)H)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000046472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005957.2-1669s1c1
Sequence:CCGGCTTGTCAATGTGAAGGGTGAACTCGAGTTCACCCTTCACATTGACAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046468    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005957.2-5743s1c1
Sequence:CCGGCCTCAGTTTCTCCATCAGCTTCTCGAGAAGCTGATGGAGAAACTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005957.2-748s1c1
Sequence:CCGGGCTGACACATTCTTCCGCTTTCTCGAGAAAGCGGAAGAATGTGTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005957.2-597s1c1
Sequence:CCGGCCGAAGTGAGTTTGGTGACTACTCGAGTAGTCACCAAACTCACTTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005957.2-128s1c1
Sequence:CCGGCCAAAGATAGTTCGAGATGTTCTCGAGAACATCTCGAACTATCTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005957.3-1477s21c1
Sequence:CCGGCTTTGAAGTCTTCGTTCTTTACTCGAGTAAAGAACGAAGACTTCAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005957.3-1056s21c1
Sequence:CCGGATGCTGCCATCCGCAACTATGCTCGAGCATAGTTGCGGATGGCAGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005957.3-1776s21c1
Sequence:CCGGAGTACGAGCTCCGGGTTAATTCTCGAGAATTAACCCGGAGCTCGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235026    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005957.3-4784s21c1
Sequence:CCGGTTACCGTAGCCTCCGTTTATGCTCGAGCATAAACGGAGGCTACGGTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)