EMAIL THIS PAGE TO A FRIEND

MTHFS

5,10-methenyltetrahydrofolate synthetase (5-formyltetrahydrofolate cyclo-ligase)

54 Gene Product Result for
Synonyms: HsT19268
UniProtKB ID: P49914, H3BQ75
Gene ID:
Human(10588) Summary: The protein encoded by this gene is an enzyme that catalyzes the conversion of 5-formyltetrahydrofolate to 5,10-methenyltetrahydrofolate, a precursor of reduced folates involved in 1-carbon metabolism. An increased activity of the encoded protein can result in an increased folate turnover rate and folate depletion. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jun 2011]
Mouse(107885) 5, 10-methenyltetrahydrofolate synthetase
Rat(300886) 5,10-methenyltetrahydrofolate synthetase (5-formyltetrahydrofolate cyclo-ligase)
chicken(415484) 5,10-methenyltetrahydrofolate synthetase (5-formyltetrahydrofolate cyclo-ligase)
cow(513372) 5,10-methenyltetrahydrofolate synthetase (5-formyltetrahydrofolate cyclo-ligase)
domestic cat(101093689) 5,10-methenyltetrahydrofolate synthetase (5-formyltetrahydrofolate cyclo-ligase)
dog(610157) 5,10-methenyltetrahydrofolate synthetase (5-formyltetrahydrofolate cyclo-ligase)
sheep(101114310) 5,10-methenyltetrahydrofolate synthetase (5-formyltetrahydrofolate cyclo-ligase)
naked mole-rat(101702108) 5,10-methenyltetrahydrofolate synthetase (5-formyltetrahydrofolate cyclo-ligase)
domestic guinea pig(101787293) 5,10-methenyltetrahydrofolate synthetase (5-formyltetrahydrofolate cyclo-ligase)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006441 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006441 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006441 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026829 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026829 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026829 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006441 Rosetta Predictions human pricing
NM_001009349 Rosetta Predictions rat pricing
NM_026829 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006441 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00159263 predicted 308
2 SASI_Hs01_00159264 predicted 608
3 SASI_Hs01_00159265 predicted 594
4 SASI_Hs01_00159266 predicted 638
5 SASI_Hs01_00159267 predicted 324
6 SASI_Hs01_00159268 predicted 414
7 SASI_Hs01_00159269 predicted 622
8 SASI_Hs01_00159270 predicted 511
9 SASI_Hs02_00341576 predicted 654
10 SASI_Hs01_00159272 predicted 654
11 SASI_Hs01_00159271 predicted 268
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009349 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00101413 predicted 709
2 SASI_Rn01_00101414 predicted 773
3 SASI_Rn01_00101415 predicted 641
4 SASI_Rn01_00101416 predicted 861
5 SASI_Rn01_00101417 predicted 764
6 SASI_Rn02_00199515 predicted 779
7 SASI_Rn01_00101418 predicted 831
8 SASI_Rn01_00101420 predicted 574
9 SASI_Rn01_00101421 predicted 864
10 SASI_Rn01_00101422 predicted 311
11 SASI_Rn01_00101419 predicted 205
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026829 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00132359 predicted 269
2 SASI_Mm01_00132360 predicted 491
3 SASI_Mm01_00132361 predicted 260
4 SASI_Mm01_00132363 predicted 279
5 SASI_Mm02_00331000 predicted 302
6 SASI_Mm01_00132364 predicted 313
7 SASI_Mm01_00132365 predicted 247
8 SASI_Mm01_00132366 predicted 194
9 SASI_Mm01_00132368 predicted 262
10 SASI_Mm02_00331001 predicted 364
11 SASI_Mm01_00132362 predicted 377
12 SASI_Mm01_00132367 predicted 486
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006441
VALIDATED
MTHFS MISSION shRNA Bacterial Glycerol Stock
5,10-methenyltetrahydrofolate synthetase (5-formyltetrahydrofolate cyclo-ligase)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000045333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_006441.1-268s1c1
Sequence:CCGGCCAGAGCAATCACATGGATATCTCGAGATATCCATGTGATTGCTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_006441.1-604s1c1
Sequence:CCGGCGAAGACTCGTCAACAGCTTACTCGAGTAAGCTGTTGACGAGTCTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_006441.1-466s1c1
Sequence:CCGGCTACTATGATGCCTATCTGAACTCGAGTTCAGATAGGCATCATAGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006441.1-278s1c1
Sequence:CCGGCACATGGATATGGTGAGAATACTCGAGTATTCTCACCATATCCATGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006441.1-305s1c1
Sequence:CCGGCCAGAGGAAATTTCTTTACTTCTCGAGAAGTAAAGAAATTTCCTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006441
VALIDATED
MTHFS MISSION shRNA shRNA Plasmid DNA
5,10-methenyltetrahydrofolate synthetase (5-formyltetrahydrofolate cyclo-ligase)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000045333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_006441.1-268s1c1
Sequence:CCGGCCAGAGCAATCACATGGATATCTCGAGATATCCATGTGATTGCTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_006441.1-604s1c1
Sequence:CCGGCGAAGACTCGTCAACAGCTTACTCGAGTAAGCTGTTGACGAGTCTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_006441.1-466s1c1
Sequence:CCGGCTACTATGATGCCTATCTGAACTCGAGTTCAGATAGGCATCATAGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006441.1-278s1c1
Sequence:CCGGCACATGGATATGGTGAGAATACTCGAGTATTCTCACCATATCCATGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006441.1-305s1c1
Sequence:CCGGCCAGAGGAAATTTCTTTACTTCTCGAGAAGTAAAGAAATTTCCTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006441
VALIDATED
MTHFS MISSION shRNA Lentiviral Transduction Particles
5,10-methenyltetrahydrofolate synthetase (5-formyltetrahydrofolate cyclo-ligase)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000045333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_006441.1-268s1c1
Sequence:CCGGCCAGAGCAATCACATGGATATCTCGAGATATCCATGTGATTGCTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_006441.1-604s1c1
Sequence:CCGGCGAAGACTCGTCAACAGCTTACTCGAGTAAGCTGTTGACGAGTCTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_006441.1-466s1c1
Sequence:CCGGCTACTATGATGCCTATCTGAACTCGAGTTCAGATAGGCATCATAGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006441.1-278s1c1
Sequence:CCGGCACATGGATATGGTGAGAATACTCGAGTATTCTCACCATATCCATGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006441.1-305s1c1
Sequence:CCGGCCAGAGGAAATTTCTTTACTTCTCGAGAAGTAAAGAAATTTCCTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026829
MTHFS MISSION shRNA Bacterial Glycerol Stock
5,10-methenyltetrahydrofolate synthetase (5-formyltetrahydrofolate cyclo-ligase)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000075738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026829.1-130s1c1
Sequence:CCGGGCCCACAATCAGTATCAGAATCTCGAGATTCTGATACTGATTGTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026829.1-565s1c1
Sequence:CCGGGAGCATGACATGAAGGTAGATCTCGAGATCTACCTTCATGTCATGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026829.1-293s1c1
Sequence:CCGGCGTCATCTGAAGAAATTGCTTCTCGAGAAGCAATTTCTTCAGATGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026829.1-250s1c1
Sequence:CCGGCGGTACCAATTCCAGAGCAATCTCGAGATTGCTCTGGAATTGGTACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026829.1-417s1c1
Sequence:CCGGCGGGTTTGACAAAGATGGCAACTCGAGTTGCCATCTTTGTCAAACCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026829
MTHFS MISSION shRNA shRNA Plasmid DNA
5,10-methenyltetrahydrofolate synthetase (5-formyltetrahydrofolate cyclo-ligase)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000075738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026829.1-130s1c1
Sequence:CCGGGCCCACAATCAGTATCAGAATCTCGAGATTCTGATACTGATTGTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026829.1-565s1c1
Sequence:CCGGGAGCATGACATGAAGGTAGATCTCGAGATCTACCTTCATGTCATGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026829.1-293s1c1
Sequence:CCGGCGTCATCTGAAGAAATTGCTTCTCGAGAAGCAATTTCTTCAGATGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026829.1-250s1c1
Sequence:CCGGCGGTACCAATTCCAGAGCAATCTCGAGATTGCTCTGGAATTGGTACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026829.1-417s1c1
Sequence:CCGGCGGGTTTGACAAAGATGGCAACTCGAGTTGCCATCTTTGTCAAACCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026829
MTHFS MISSION shRNA Lentiviral Transduction Particles
5,10-methenyltetrahydrofolate synthetase (5-formyltetrahydrofolate cyclo-ligase)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000075738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026829.1-130s1c1
Sequence:CCGGGCCCACAATCAGTATCAGAATCTCGAGATTCTGATACTGATTGTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026829.1-565s1c1
Sequence:CCGGGAGCATGACATGAAGGTAGATCTCGAGATCTACCTTCATGTCATGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026829.1-293s1c1
Sequence:CCGGCGTCATCTGAAGAAATTGCTTCTCGAGAAGCAATTTCTTCAGATGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026829.1-250s1c1
Sequence:CCGGCGGTACCAATTCCAGAGCAATCTCGAGATTGCTCTGGAATTGGTACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026829.1-417s1c1
Sequence:CCGGCGGGTTTGACAAAGATGGCAACTCGAGTTGCCATCTTTGTCAAACCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)