EMAIL THIS PAGE TO A FRIEND

MTHFSD

methenyltetrahydrofolate synthetase domain containing

37 Gene Product Result for
Gene ID:
Mouse(234814) methenyltetrahydrofolate synthetase domain containing
Rat(687539) methenyltetrahydrofolate synthetase domain containing
domestic guinea pig(100735031) methenyltetrahydrofolate synthetase domain containing
naked mole-rat(101706947) methenyltetrahydrofolate synthetase domain containing
sheep(101105679) methenyltetrahydrofolate synthetase domain containing
Zebrafish(566203) methenyltetrahydrofolate synthetase domain containing
chicken(415823) methenyltetrahydrofolate synthetase domain containing
cow(509897) methenyltetrahydrofolate synthetase domain containing
domestic cat(101094719) methenyltetrahydrofolate synthetase domain containing
dog(609306) methenyltetrahydrofolate synthetase domain containing
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2107984 Anti-MTHFSD antibody produced in rabbit IgG fraction of antiserum zebrafish, human, horse, rat, mouse, guinea pig, canine, bovine, rabbit, pig
immunohistochemistry, western blot pricing
AV40987 Anti-MTHFSD antibody produced in rabbit IgG fraction of antiserum, lyophilized powder bovine, horse, mouse, zebrafish, human, rabbit, chicken, canine
immunohistochemistry, western blot pricing
HPA041333 Anti-MTHFSD antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB2104567 Anti-MTHFSD, (N-terminal) antibody produced in rabbit affinity isolated antibody human, rabbit, horse, mouse, bovine, guinea pig, zebrafish
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022764 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022764 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022764 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172761 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172761 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172761 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022764 Rosetta Predictions human pricing
NM_172761 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022764 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00030300 predicted 887
2 SASI_Hs01_00030301 predicted 1303
3 SASI_Hs01_00030302 predicted 511
4 SASI_Hs01_00030303 predicted 956
5 SASI_Hs01_00030304 predicted 702
6 SASI_Hs01_00030305 predicted 417
7 SASI_Hs01_00030306 predicted 638
8 SASI_Hs01_00030307 predicted 436
9 SASI_Hs02_00356037 predicted 457
10 SASI_Hs02_00356038 predicted 215
11 SASI_Hs01_00030299 predicted 300
12 SASI_Hs01_00030308 predicted 420
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172761 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00344625 predicted 1291
2 SASI_Mm01_00162105 predicted 1103
3 SASI_Mm01_00162106 predicted 1541
4 SASI_Mm01_00162107 predicted 1218
5 SASI_Mm01_00162108 predicted 1298
6 SASI_Mm02_00344626 predicted 214
7 SASI_Mm01_00162109 predicted 1112
8 SASI_Mm01_00162110 predicted 284
9 SASI_Mm01_00162112 predicted 535
10 SASI_Mm01_00162114 predicted 1624
11 SASI_Mm01_00162111 predicted 1526
12 SASI_Mm01_00162113 predicted 1026
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022764
MTHFSD MISSION shRNA Bacterial Glycerol Stock
methenyltetrahydrofolate synthetase domain containing
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156120    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022764.1-617s1c1
Sequence:CCGGCGACATCACTGTGGACTACATCTCGAGATGTAGTCCACAGTGATGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022764.1-339s1c1
Sequence:CCGGGCAACTAAAGACATCTTGAGACTCGAGTCTCAAGATGTCTTTAGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150750    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022764.1-1543s1c1
Sequence:CCGGGAACAGGAGAAGATGAACAAACTCGAGTTTGTTCATCTTCTCCTGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022764.1-210s1c1
Sequence:CCGGGTTAAAGTGGACCCTGATAAACTCGAGTTTATCAGGGTCCACTTTAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022764.1-57s1c1
Sequence:CCGGCAGGACATACGTGAACAAATTCTCGAGAATTTGTTCACGTATGTCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151970    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022764.1-2116s1c1
Sequence:CCGGCAAGTGTTCTTTGAAGCACATCTCGAGATGTGCTTCAAAGAACACTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155049    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022764.1-225s1c1
Sequence:CCGGGATAAACCACTGGAAGGCGTTCTCGAGAACGCCTTCCAGTGGTTTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022764.2-150s21c1
Sequence:CCGGTCACAGGATACCCAACTTTAACTCGAGTTAAAGTTGGGTATCCTGTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022764.2-317s21c1
Sequence:CCGGGACTGAGAACGGGATTGTTTACTCGAGTAAACAATCCCGTTCTCAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022764
MTHFSD MISSION shRNA shRNA Plasmid DNA
methenyltetrahydrofolate synthetase domain containing
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156120    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022764.1-617s1c1
Sequence:CCGGCGACATCACTGTGGACTACATCTCGAGATGTAGTCCACAGTGATGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022764.1-339s1c1
Sequence:CCGGGCAACTAAAGACATCTTGAGACTCGAGTCTCAAGATGTCTTTAGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150750    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022764.1-1543s1c1
Sequence:CCGGGAACAGGAGAAGATGAACAAACTCGAGTTTGTTCATCTTCTCCTGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022764.1-210s1c1
Sequence:CCGGGTTAAAGTGGACCCTGATAAACTCGAGTTTATCAGGGTCCACTTTAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022764.1-57s1c1
Sequence:CCGGCAGGACATACGTGAACAAATTCTCGAGAATTTGTTCACGTATGTCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151970    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022764.1-2116s1c1
Sequence:CCGGCAAGTGTTCTTTGAAGCACATCTCGAGATGTGCTTCAAAGAACACTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155049    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022764.1-225s1c1
Sequence:CCGGGATAAACCACTGGAAGGCGTTCTCGAGAACGCCTTCCAGTGGTTTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022764.2-150s21c1
Sequence:CCGGTCACAGGATACCCAACTTTAACTCGAGTTAAAGTTGGGTATCCTGTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022764.2-317s21c1
Sequence:CCGGGACTGAGAACGGGATTGTTTACTCGAGTAAACAATCCCGTTCTCAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022764
MTHFSD MISSION shRNA Lentiviral Transduction Particles
methenyltetrahydrofolate synthetase domain containing
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156120    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022764.1-617s1c1
Sequence:CCGGCGACATCACTGTGGACTACATCTCGAGATGTAGTCCACAGTGATGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022764.1-339s1c1
Sequence:CCGGGCAACTAAAGACATCTTGAGACTCGAGTCTCAAGATGTCTTTAGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150750    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022764.1-1543s1c1
Sequence:CCGGGAACAGGAGAAGATGAACAAACTCGAGTTTGTTCATCTTCTCCTGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022764.1-210s1c1
Sequence:CCGGGTTAAAGTGGACCCTGATAAACTCGAGTTTATCAGGGTCCACTTTAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022764.1-57s1c1
Sequence:CCGGCAGGACATACGTGAACAAATTCTCGAGAATTTGTTCACGTATGTCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151970    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022764.1-2116s1c1
Sequence:CCGGCAAGTGTTCTTTGAAGCACATCTCGAGATGTGCTTCAAAGAACACTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155049    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022764.1-225s1c1
Sequence:CCGGGATAAACCACTGGAAGGCGTTCTCGAGAACGCCTTCCAGTGGTTTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022764.2-150s21c1
Sequence:CCGGTCACAGGATACCCAACTTTAACTCGAGTTAAAGTTGGGTATCCTGTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022764.2-317s21c1
Sequence:CCGGGACTGAGAACGGGATTGTTTACTCGAGTAAACAATCCCGTTCTCAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172761
VALIDATED
MTHFSD MISSION shRNA Bacterial Glycerol Stock
methenyltetrahydrofolate synthetase domain containing
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000201205    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172761.1-1687s1c1
Sequence:CCGGGCATCCAGAGAACACAAACTTCTCGAGAAGTTTGTGTTCTCTGGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172761.1-492s1c1
Sequence:CCGGGATTCCAGTGTTCTTGTGGATCTCGAGATCCACAAGAACACTGGAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172761.1-698s1c1
Sequence:CCGGCGACCTCACAGTTGACTACATCTCGAGATGTAGTCAACTGTGAGGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172761.1-385s1c1
Sequence:CCGGCAGGGCTGTTTAACAAGATCACTCGAGTGATCTTGTTAAACAGCCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172761
VALIDATED
MTHFSD MISSION shRNA shRNA Plasmid DNA
methenyltetrahydrofolate synthetase domain containing
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000201205    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172761.1-1687s1c1
Sequence:CCGGGCATCCAGAGAACACAAACTTCTCGAGAAGTTTGTGTTCTCTGGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172761.1-492s1c1
Sequence:CCGGGATTCCAGTGTTCTTGTGGATCTCGAGATCCACAAGAACACTGGAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172761.1-698s1c1
Sequence:CCGGCGACCTCACAGTTGACTACATCTCGAGATGTAGTCAACTGTGAGGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172761.1-385s1c1
Sequence:CCGGCAGGGCTGTTTAACAAGATCACTCGAGTGATCTTGTTAAACAGCCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172761
VALIDATED
MTHFSD MISSION shRNA Lentiviral Transduction Particles
methenyltetrahydrofolate synthetase domain containing
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000201205    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172761.1-1687s1c1
Sequence:CCGGGCATCCAGAGAACACAAACTTCTCGAGAAGTTTGTGTTCTCTGGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172761.1-492s1c1
Sequence:CCGGGATTCCAGTGTTCTTGTGGATCTCGAGATCCACAAGAACACTGGAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172761.1-698s1c1
Sequence:CCGGCGACCTCACAGTTGACTACATCTCGAGATGTAGTCAACTGTGAGGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172761.1-385s1c1
Sequence:CCGGCAGGGCTGTTTAACAAGATCACTCGAGTGATCTTGTTAAACAGCCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)